| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Previous Article | Next Article ![]()
Eukaryotic Cell, October 2003, p. 1061-1068, Vol. 2, No. 5
1535-9778/03/$08.00+0 DOI: 10.1128/EC.2.5.1061-1068.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
and Andrew K. Vershon*
Waksman Institute and Department of Molecular Biology and Biochemistry, Rutgers University, Piscataway, New Jersey 08854
Received 1 April 2003/ Accepted 28 July 2003
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Mutations that affect any steps in ribosome biogenesis will affect the ability of the cell to carry out translation at a normal level. These mutations would be expected to exhibit pleiotropic phenotypes through their general effects on a variety of cellular processes. Hence, a variety of mutations initially identified as playing a role in a specific cellular process have turned out on subsequent analysis to affect the more general process of translation. An example of this is the SFP1 gene, which encodes a protein with an unusual split zinc finger motif. SFP1 was initially identified in a screen for genes that altered import of nuclear proteins when present on high-copy-number plasmids (3). Overexpression of SFP1 was found to result in the mislocalization of several endogenous nucleolar proteins, although the null mutant did not appear to be altered in nuclear import or protein localization. These results suggested that Sfp1 played some uncharacterized role in nuclear localization.
The SFP1 gene was also identified in a differential-display screen for genes whose expression increased after DNA damage (27). Subsequent Northern blot analysis showed that the SFP1 transcript is induced sixfold after a 90-min exposure to the DNA-alkylating agent methyl methane sulfonate (MMS). Additionally, sfp1 cells were found to be more sensitive to ionizing radiation and alkylating agents than SFP1 cells, consistent with the presence of a defect in DNA repair. Finally, sfp1 mutant cells were observed to be significantly smaller than wild-type cells and showed a significant defect in their growth rate (3). Based on the precedent of wee mutants in Schizosaccharomyces pombe, we tested whether the sfp1 mutants had difficulty regulating the transition from the G2 phase of the cell cycle into mitosis. We found that the cells were in fact unable to appropriately regulate this transition, which led to the hypothesis that Sfp1 was a negative regulator of the G2/M transition after DNA damage and during the normal cell cycle. The small cell size of the sfp1 strain was also observed in a recent screen for mutations that affect critical cell size at START, which occurs late in the G1 phase (11). However, analysis in the latter work indicated that the fundamental defect in the sfp1 strain may be a defect not in regulating cell cycle progression or nuclear localization but rather in regulating ribosome biogenesis.
In this paper we further investigate the role of Sfp1 and confirm that it has an important role in ribosome biogenesis. We also present data supporting the model that Sfp1 functions as a transcriptional regulator of genes required for ribosome biogenesis.
| MATERIALS AND METHODS |
|---|
|
|
|---|
1 leu2
0 lys2
0 ura3
0) and sfp1(5312) strains in an SC288C background were also used in this assay (4) (Research Genetics). Plasmid pIF13 (pRS424-SFP1-HAx3) was constructed by PCR amplification of the SFP1 open reading frame from a genomic subclone to include 488 bp upstream and 176 bp downstream of the open reading frame with overhanging PvuII sites. The PCR fragment was cloned into the PvuII sites of pRS424. An XmaI site was integrated immediately downstream of ATG by using a three-step PCR. Complementary oligonucleotides encoding an HAx3 epitope with XmaI-compatible ends were annealed and ligated into the pRS424-SFP1 vector containing the integrated XmaI site. Transcription reporter constructs were constructed in the pTBA30 vector (1). Reporter constructs were made by cloning oligonucleotides with a sequence corresponding to bases -210 to -158 of the NSR1 promoter, containing two ribosomal RNA processing element (RRPE) sites flanking a single polymerase A and C (PAC) element, into the XhoI sites of pTBA30. pIF111 contains the NSR1 promoter region fragment in a single copy in pTBA30. Plasmid pIF117 contains bases -210 to -158 of the NSR1 promoter with a mutant PAC element that was made by base substitutions in the oligonucleotides cloned into the XhoI site of pTBA30 (GCGATGAGCTG to CATCGTAACTG). Plasmid pIF119 contains bases -210 to -158 of the NSR1 promoter with mutant RRPE elements that were made by base substitutions in the oligonucleotides cloned into the XhoI site of pTBA30 (GAAAAATTT to CCCCCATGG and GAAAATTTT to CCCCCTTGG). Plasmid pTBA23 was used as a control for activation (1). ß-Galactosidase assays monitoring expression from these reporters were performed as previously described (12).
Translation drug sensitivity. Yeast strains were grown in a rich medium (YPD, containing 2% [wt/vol] peptone, 1% [wt/vol] yeast extract, and 2% [wt/vol] dextrose). For determination of sensitivity to translation drugs, cultures were grown to mid-log phase (optical density at 600 nm [OD600], 0.5) and plated for confluent growth on YPD plates. Filter disks were placed on the plates, and 10 µl of 1 M paromomycin, 25 mM hygromycin, or 5 mM cycloheximide was spotted onto each disk. Plates were incubated at 30°C for 48 h (wild type) or 72 h (sfp1). Sensitivity is expressed as the average radius of inhibition of growth.
MMS sensitivity. Yeast strains were grown in a rich medium (YPD). Cultures were grown to mid-log phase (OD600, 0.5), serially diluted 10-fold, and spotted onto YPD plates containing 0.009% MMS. Plates were incubated at 30°C for 72 h (sfp1) and photographed.
Determination of total translation. Wild-type (DN1162) and sfp1 (DN1300) cultures were grown in a synthetic medium (SD, containing 0.67% [wt/vol] yeast nitrogen base supplemented with amino acids and 2% [wt/vol] dextrose) lacking methionine (SD-Met) at 30°C to an OD600 of 0.5. At time zero, cold methionine was added to a final concentration of 0.5 µM and [35S]methionine was added to a final concentration of 1 µCi/ml [EXPRE35S35S (35S)Protein Labeling Mix, containing 7.9 mCi of [35S]methionine/ml; New England Nuclear Life Sciences]. At given times, 1-ml aliquots were taken in duplicate from each culture and the OD600 was measured. Trichloroacetic acid (TCA) was added to a final concentration of 2.5%, and aliquots were placed on ice for 10 min, followed by incubation at 70°C for 20 min. The total lysate was then filtered through a 25-mm-pore-size Whatman GF/C filter. The filters were washed twice with 5 ml of 5% TCA and twice with 5 ml of 95% ethanol; then they were allowed to air dry for 2 h. Filters were counted by scintillation, and the values for duplicate samples were averaged.
Polyribosome profile analysis. Polyribosome preparation was performed based on a procedure described previously (2). One hundred milliliters of wild-type (DN1162) and sfp1 (DN1300) cultures were grown to an OD600 of 0.5, and cycloheximide was added to a final concentration of 0.1 mg/ml. Ice was added directly to the cultures, and the cells were pelleted by centrifugation at 12,000 x g for 5 min. The cell pellets were washed once in 10 ml of ice-cold lysis buffer (10 mM Tris-HCl [pH 7.5], 0.1 M NaCl, 30 mM MgCl2, 50 µg of cycloheximide/ml, 200 µg of heparin/ml, 0.2% diethyl pyrocarbonate) and resuspended in 0.5 ml of cold lysis buffer in 1.5-ml microcentrifuge tubes. A 250-µl volume of glass beads was added, and the cells were lysed by vortexing eight times for 30 s each time. The lysates were centrifuged for 5 min at 12,000 x g and 4°C, and the supernatants were transferred to clean tubes. The OD260 was measured, and 5 to 10 OD260 units was layered onto a 7-ml linear sucrose gradient (7 to 49% [wt/vol] sucrose in gradient buffer, consisting of 50 mM Tris acetate [pH 7.0], 50 mM NH4Cl, 12 mM MgCl2, 1 mM dithiothreitol, and 0.1% diethyl pyrocarbonate). The gradients were centrifuged in a Beckman SW28 rotor at 27,000 rpm for 4 h and fractionated, and the sucrose gradient profiles were recorded by absorption at A254.
r-protein localization assays. The Rpl11b-green fluorescent protein (GFP) fusion plasmid (21) was transformed into wild-type (DN1162), sfp1 (DN1300), and kap120 (PSY1082) strains. Cells were grown in selective medium at 30°C to mid-log phase (OD600, 0.5) and shifted to 37°C for 1 h. Three milliliters of culture was then removed and fixed by adding formaldehyde to a final concentration of 3.7% and agitating at 30°C for 30 min. Cells were harvested and washed twice with 1 ml of solution P (0.1 M KPi [pH 6.5]-1.2 M sorbitol) and placed at 4°C. The remaining culture was shifted back to 30°C, and 3-ml aliquots were removed at 30 and 60 min and fixed as described above. Cells were permeabilized by adding Triton X-100 to a final concentration of 0.5% and incubating at room temperature for 10 min. 4',6'-Diamidino-2-phenylindole (DAPI) was added to fixed cells to a final concentration of 1 µg/ml and incubated for 3 min at room temperature. Cells were washed twice in 1 ml of 1x phosphate-buffered saline and stored at 4°C in 100 µl of 1x phosphate-buffered saline. Rpl11b-GFP was visualized by fluorescence microscopy using a Zeiss microscope. Rps2-GFP was localized as described previously (17). The Rps2-GFP fusion plasmid (17) was transformed into wild-type, sfp1, and noc4-1 strains, which were all in a S288C strain background (4) (Research Genetics). Fixing and DAPI staining were performed as described above.
Pulse-chase labeling of rRNA. rRNA processing was assayed in the wild-type and sfp1 mutant strains based on a procedure described previously (21). One-hundred-milliliter cultures were grown in SD-Met to a final OD600 of 0.5. Cells were harvested and resuspended in 4 ml of SD-Met, and 250 µCi of L-[methyl-3H]methionine (1.0 mCi/ml; New England Nuclear Life Sciences) was added. Cells were incubated for 5 min at 25°C. After 3 min, cultures were chased with cold methioine in -Met medium to a final concentration of 5.1 mM. Aliquots (1 ml) were removed at various time points and pelleted, and the supernatant was removed before the pellets were placed on dry ice. Total RNA was prepared from labeled cells by extraction with hot acid-phenol (6). Ten thousand counts per minute of each sample was resolved on a 1.2% formaldehyde gel. RNA was transferred to a nylon membrane (Qiabrane; Qiagen) by capillary transfer. The membrane was air dried and sprayed with En3Hance (New England Nuclear Life Sciences), according to the manufacturer's protocol. Blots were exposed to Kodak X-Omat/AR film for 3 days at -80°C and quantitated using Alphaease FC software (Alpha Innotech).
rRNA levels. Five-milliliter cultures were grown in rich medium to an OD600 of 0.5. Cells were pelleted, and total RNA was isolated by using hot acid-phenol extraction (6). Equal concentrations of total RNA were loaded onto a 1.2% formaldehyde agarose gel. The RNA was then transferred to a nitrocellulose filter, and the rRNA gel was probed by Northern blot analysis for 25 and 18S rRNAs as well as ACT1 message (5). Quantitation to determine the ratios of 25 and 18S rRNAs to ACT1 was performed using IPLabgel (Molecular Dynamics).
Chromatin immunoprecipitation. Plasmids pIF13 (pRS424-SFP1-HAx3) and pIF12 (pRS424-SFP1) were transformed into DN1300 (sfp1). Chromatin immunoprecipitations were performed as described previously (13). Oligonucleotide primers were chosen to amplify approximately 300- and 200-bp fragments from the promoters of Sfp1 target genes and control genes, respectively. The following primers were used to amplify the promoters of putative Sfp1 target genes: for NSR1, 5' GCCTGATGTATGGGTCCCCATG 3' and 5' CCTGCCTGGGTTGAGTGATCCG 3'; for RPA190, 5' GCCCGCTATCGGAGGGTCTCAG 3' and 5' CACTGTATAGTTAATGGATACCTAAG 3'; for SIK1, 5' GAAGATAATACTGTATACTAGTG 3' and 5' GCCATCTTTCACTAAATACTGTTC 3'; for NOP5, 5' CAAGATCCTGAACCAGCGTTC 3' and 5' GAGCATAACCAGCTGAAGTTTC 3'; for SEH1, 5' CAAACCTTCACCTGGTGGTGCG 3' and 5' CATCATGAACTAAATCATCATGCCCAC; and for YGR250C, 5' GTCGGAGATTCCCTATTGGGCGG 3' and 5' CATCCTCGAAACTTCTGATGCGG 3'. One microliter of product from total chromatin and immunoprecipitation reactions was used as a template in the PCRs.
| RESULTS |
|---|
|
|
|---|
|
|
|
The 60 and 40S ribosomal subunits are not exported in an sfp1 strain. To assemble the ribosomal subunits, r-proteins must be imported into the nucleus. The assembled ribosomes are then exported from the nucleus. Since SFP1 was originally identified based on a phenotype that altered import or export from the nucleus (3), it was therefore possible that the defects in translation and 60S ribosomal subunit levels in the sfp1 mutant could be caused by improper localization of ribosomal components. To determine if the sfp1 mutant causes defects in any of these steps in ribosome biogenesis, we used an assay to monitor the presence and export of the 60S subunit (21). Rpl11b is an r-protein that is incorporated into the 60S ribosomal subunit during the later stages of ribosome biogenesis. In wild-type cells the Rpl11b-GFP fusion protein was evenly distributed in the cytoplasm (Fig. 3A) (21). In contrast, it has been shown previously that the Rpl11b-GFP fusion protein accumulates in the nucleus in mutants, such as kap120 mutants, which have defects in rRNA processing and r-protein import or export (Fig. 3A) (21). We observed a similar accumulation of Rpl11b-GFP in the nuclei of sfp1 cells (Fig. 3A).
|
sfp1 cells demonstrate a delay in rRNA processing. The nuclear accumulation of Rpl11b-GFP can be a result of a defect in rRNA processing (21). To examine if Sfp1 was involved in rRNA processing, an rRNA pulse-chase experiment was performed to determine if specific steps in processing were blocked. rRNA was radiolabeled in vivo with L-[methyl-3H]methionine, and aliquots were removed at time points after the chase to monitor the processing of the 3H-labeled transcript into mature 18 and 25S rRNAs. In a wild-type cell, the majority of the 3H-labeled pre-rRNA was processed to mature 25 and 18S rRNAs by the 5-min time point (Fig. 4). However, in the sfp1 cells, there was a significant delay in processing of the 27S pre-rRNA into the mature 25S rRNA. Quantification of the gel showed that 84% of the 27S pre-rRNA was processed to 25S rRNA at 5 min in a wild-type strain, while only 60% of the 27S precursor rRNA was processed into mature 25S rRNA in the sfp1 strain. Since the 25S rRNA is incorporated into the 60S ribosomal subunit, the delay in processing of the 27S pre-rRNA may explain the reduced levels of 60S ribosomal subunits and the export defect. There is also a slight delay in processing of the 20S pre-rRNA into mature 18S rRNA in the sfp1 strain. In wild-type cells, 90% of the 20S pre-rRNA was processed to the mature 18S rRNA at the 5-min time point, compared to 64% in the sfp1 strain.
|
|
|
Mutational analysis of Sfp1 shows that the two C-terminal zinc fingers are essential for Sfp1 function.
Examination of the Sfp1 sequence reveals several zinc finger motifs and an acidic domain that may be required for its function. To investigate if these domains are required for Sfp1 function, we constructed a series of deletions and point mutations in the protein and examined their phenotypes by assaying for the abilities of the mutants to complement the increased sensitivity to translation drugs of an sfp1 mutant strain. The two C-terminal fingers exhibit extensive homology with each other. Deletion of both C-terminal zinc fingers (
606-682) conferred sensitivity to translation drugs comparable to that of the sfp1 strain. However, deletion of each of the C-terminal fingers individually (
606-620 or
663-682) partially complemented the mutant phenotype (data not shown). These results suggest that they may perform redundant functions, possibly binding similar DNA sequences.
It is possible that deleting one individual zinc finger may alter the folding of the protein and the relative position of the second zinc finger. To address this concern, the conserved cysteine and histidine residues that typically chelate the zinc atom to form a zinc finger were converted to alanine. Disruption of both C-terminal zinc fingers (Znf2-3A Znf3-4A) (C605A, H618A, H623A, C661A, C664A, H667A, and H680A) in either low or high copy numbers caused a phenotype that was identical to that of an sfp1 strain (Table 3). However, disruption of the individual C-terminal zinc fingers (Znf2-3A or Znf3-4A) resulted in only a very slight sensitivity in this assay when they were expressed in high copy numbers (Table 3). However, when these disruptions were expressed in a single copy, the sensitivity to translation drugs was much more dramatic. This suggests that the proteins are partially functional and that high-copy expression of these mutants can compensate for a partial loss of function. In contrast to the effects of the C-terminal zinc fingers, deletion of the N-terminal zinc finger (amino acids 195 to 220), caused no substantial phenotype, indicating that this single zinc finger is not as important in Sfp1 function as the C-terminal fingers.
|
627-656). This spacing mutant fully complemented the sfp1-null mutant when assayed for drug sensitivity and MMS (Table 3). Sfp1 also contains an acidic domain. In other proteins, acidic domains are often implicated in transcriptional activation and are thought to interact with histones or other trans-acting proteins to activate transcription (9, 15, 22). DNA microarray analysis and our transcription reporter assays indicate that Sfp1, when overexpressed, induces a large number of genes involved in ribosome biogenesis, suggesting that it is functioning as an activator protein. We therefore deleted the acidic domain of Sfp1 to determine if it was required for function in vivo. However, this mutant complemented the sfp1 mutant phenotype for translation drug and MMS sensitivity, indicating that, if Sfp1 is functioning as a transcriptional activator, it does not require the acidic domain. All of the mutant constructs were also tested for their abilities to activate transcription from the reporter with a mutated PAC element (pIF117) at a high copy number (Table 3). Most of the mutations had the same effect in the transcription reporter assay as they did in the translation drug assay. Mutations in either of the two C-terminal zinc fingers resulted in a complete loss of activation from this reporter, while deletion of the N-terminal zinc finger or the acidic domain resulted in levels of activation comparable to that of the wild type. Interestingly, while altering the spacing between the two C-terminal zinc fingers had no effect on translation drug sensitivity, this deletion resulted in a loss of transcriptional activation from the reporter. It is quite possible that the transcription assay is a much more sensitive assay than the translation drug disk diffusion assay.
| DISCUSSION |
|---|
|
|
|---|
Defects in translation are also frequent causes of small cell size (8). We reasoned that it was therefore possible that Sfp1 is involved in the process of translation as well. This model has been supported by the finding that Sfp1 is required for wild-type levels of expression of the genes involved in ribosome biogenesis (11). We have shown that expression and processing of rRNA are significantly delayed in a sfp1 mutant and that r-proteins are not properly localized in the cell. The defects in expression, processing, and localization of ribosomal components are the likely cause for the slight reduction in the number of 60S subunits, and therefore the reduced numbers of higher-order polysomes, that we observed in the gradient profiles. The reduced number of polysomes is likely the cause of the decrease in total translation and the sensitivity to translation inhibitors that we observed in the sfp1 mutant.
The role of Sfp1 as a transcriptional activator of genes involved in ribosome biogenesis can be used to explain most of the phenotypes previously identified. It was shown that SFP1 overexpression interfered with proper nuclear localization of a mitochondrial protein containing a nuclear localization sequence (3). The higher levels of Sfp1 in the cell likely stimulated ribosome biogenesis. Since ribosomal subunits and r-proteins are continuously shuttled in and out of the nucleus, abnormally high levels of ribosomal subunit trafficking may interfere with the localization of other nuclear proteins or prevent complete assembly of ribosomal subunits. This model is supported by the finding that the sfp1 mutant showed no defect in localization of nuclear proteins (3).
The role of Sfp1 in transcriptional regulation of ribosome biogenesis genes may also explain the DNA damage and checkpoint phenotypes previously observed in an sfp1 mutant strain (27). The inability of sfp1 cells to arrest at the G2/M checkpoint may be the result of the cell being unable to properly synthesize the proteins required to respond to DNA damage. Furthermore, the induction of SFP1 transcription in response to treatment with MMS may be likened to the induction of stress response proteins. Since a large amount of proteins must be present to respond to DNA damage, Sfp1 may be stimulating ribosome biogenesis in order for the cell to synthesize the proteins needed to respond to these stresses. Alternatively, it is possible that this could be the result of an adaptation response. SFP1 expression was shown to be induced after prolonged exposure to MMS (27). Since many cell stresses cause ribosome biogenesis to be reduced, over time this biogenesis is likely to be restored as the cells adapt to these stresses. However, it remains intriguing that G2/M progression in the normal cell cycle, i.e., in the absence of stress, is also affected in the sfp1 mutant (27).
Role of Sfp1 as a transcription factor. Recent microarray experiments have shown that Sfp1 is required for the expression of a large number of genes involved in ribosome biogenesis (11). Given that Sfp1 contains DNA-binding and activator motifs that are common to many transcription factors, it is possible that Sfp1 is functioning as a transcriptional regulatory protein of these genes. Many of the genes induced by ectopic expression of Sfp1 have two conserved promoter elements, termed RRPE and PAC (10, 25), that are often variably spaced with respect to each other. We have shown that transcription activated by the RRPE promoter elements is Sfp1 dependent in vivo. ß-Galactosidase reporter assays show that in the absence of Sfp1, transcription from a reporter construct containing RRPE and PAC elements is reduced threefold in comparison to the expression in the wild-type strain (Table 2, pIF111). In contrast, high-copy expression of Sfp1 caused more than a twofold increase in the level of expression of the reporter. Thus, it is possible that Sfp1 may directly activate transcription through these elements. Mutational analysis of RRPE and PAC suggests that the PAC element serves as a repressing element and the RRPE elements function to activate transcription from these promoters in an Sfp1-dependent manner.
If Sfp1 was directly binding to these promoters, one attractive model is that individual zinc fingers in Sfp1 recognize each of these elements to regulate transcription at these promoters. The two C-terminal zinc fingers of Sfp1 are highly conserved and likely bind to very similar DNA sequences. In support of this model, we have shown that mutations in both C-terminal zinc fingers completely eliminate the function of the protein. Mutations in one finger or the other give rise to a partially defective phenotype with respect to translation drug sensitivity, suggesting that they make similar contributions to the function of the protein. The loss of one of the zinc finger motifs likely reduces the binding affinity of the protein for DNA or protein cofactors, resulting in partial activity.
Sfp1 was shown to bind to promoters of a subset of genes involved in ribosome biogenesis, as well as genes involved in nuclear import, in a genomewide chromatin immunoprecipitation screen (14). However, most of these promoters lacked RRPE and PAC elements, and none of these genes were upregulated when Sfp1 was overexpressed, or repressed in the absence of Sfp1 (11). Additionally, none of the genes identified in the Sfp1 microarray study were bound by Sfp1 in the genomic chromatin immunoprecipitation analysis. This would suggest that if Sfp1 is regulating genes containing RRPE and PAC elements, this regulation is likely occurring through an indirect mechanism. In support of this model, using chromatin immunoprecipitation assays with an epitope-tagged Sfp1 that complements the sfp1 mutant phenotype, we have been unable to show that Sfp1 is specifically associated with several different promoters of genes containing RRPE and PAC elements that are involved in ribosome biogenesis (data not shown). Additionally, we were unable to show that Sfp1 was bound to the promoters of several of the genes identified by the global chromatin immunoprecipitation experiment (data not shown). We have also been unable to detect Sfp1-dependent binding to fragments containing the RRPE and PAC elements by electrophoretic mobility shift assays using crude yeast extracts (data not shown). It is possible that Sfp1 does not directly bind to DNA at these promoters and is therefore unable to cross-link with high efficiency. Alternatively, Sfp1 may be acting indirectly, possibly by activating an activator protein that functions at these promoters. In the absence of Sfp1, the activator may not be expressed or may fail to bind the RRPE elements, preventing transcription from these constructs. This hypothesis is supported by data showing that, in the absence of Sfp1, activation from a construct containing RRPE and PAC elements is reduced to background levels compared to activation in a wild-type strain. It is also supported by data showing that mutation of the RRPE elements causes a complete loss of activation from these constructs. Mutation of the PAC element causes an increase in activation from this construct (Table 2, pIF117), suggesting that it binds by a repressor. This activation is induced sixfold when SFP1 is overexpressed, and activation is lost in an sfp1 strain. These results suggest that Sfp1 is acting indirectly as a transcription factor at these promoters, most likely by activating an activator protein. This model is also supported by the fact that levels of Sfp1 in a wild-type cell are very low (27), calling into question if there is enough protein in the cell to bind to the large number of promoters that were identified in the microarray experiments (11).
If Sfp1 is functioning as a transcription factor that specifically binds to the promoters of a subset of ribosomal biogenesis genes, or serves as a potential upstream regulator, it is not surprising that deletion of Sfp1 imparts the translation-specific defects we have observed. Failure to activate transcription of the genes containing RRPE and PAC elements would have drastic implications within the cell. The failure to fully activate many of these genes would significantly reduce the cell's ability to synthesize ribosomes, resulting in a global reduction of cellular translation, which in turn would result in defects in many essential cellular functions.
| ACKNOWLEDGMENTS |
|---|
This work is supported by a grant from the National Institutes of Health (GM57058) to D.N. and A.K.V.
| FOOTNOTES |
|---|
Present address: PAREXEL International, Bedminster, N.J. ![]()
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Appl. Environ. Microbiol. | Infect. Immun. | J. Bacteriol. |
|---|---|---|
| Mol. Cell Biol. | Microbiol. Mol. Biol. Rev. | ALL ASM JOURNALS |