Eukaryotic Cell
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Other Versions of this Article:
EC.00249-07v1
6/11/1979    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Moraes, M. C. S.
Right arrow Articles by Castilho, B. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Moraes, M. C. S.
Right arrow Articles by Castilho, B. A.

 Previous Article  |  Next Article 

Eukaryotic Cell, November 2007, p. 1979-1991, Vol. 6, No. 11
1535-9778/07/$08.00+0     doi:10.1128/EC.00249-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Novel Membrane-Bound eIF2{alpha} Kinase in the Flagellar Pocket of Trypanosoma brucei{triangledown}

Maria Carolina S. Moraes,1 Teresa C. L. Jesus,1 Nilce N. Hashimoto,1 Madhusudan Dey,2 Kevin J. Schwartz,3 Viviane S. Alves,1 Carla C. Avila,1 James D. Bangs,3 Thomas E. Dever,2 Sergio Schenkman,1 and Beatriz A. Castilho1*

Departamento de Microbiologia, Imunologia e Parasitologia, Universidade Federal de São Paulo, São Paulo, Brazil,1 Laboratory of Gene Regulation and Development, National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, Maryland,2 Department of Medical Microbiology and Immunology, University of Wisconsin School of Medicine and Public Health, Madison, Wisconsin3

Received 11 July 2007/ Accepted 3 September 2007


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Translational control mediated by phosphorylation of the alpha subunit of the eukaryotic initiation factor 2 (eIF2{alpha}) is central to stress-induced programs of gene expression. Trypanosomatids, important human pathogens, display differentiation processes elicited by contact with the distinct physiological milieu found in their insect vectors and mammalian hosts, likely representing stress situations. Trypanosoma brucei, the agent of African trypanosomiasis, encodes three potential eIF2{alpha} kinases (TbeIF2K1 to -K3). We show here that TbeIF2K2 is a transmembrane glycoprotein expressed both in procyclic and in bloodstream forms. The catalytic domain of TbeIF2K2 phosphorylates yeast and mammalian eIF2{alpha} at Ser51. It also phosphorylates the highly unusual form of eIF2{alpha} found in trypanosomatids specifically at residue Thr169 that corresponds to Ser51 in other eukaryotes. T. brucei eIF2{alpha}, however, is not a substrate for GCN2 or PKR in vitro. The putative regulatory domain of TbeIF2K2 does not share any sequence similarity with known eIF2{alpha} kinases. In both procyclic and bloodstream forms TbeIF2K2 is mainly localized in the membrane of the flagellar pocket, an organelle that is the exclusive site of exo- and endocytosis in these parasites. It can also be detected in endocytic compartments but not in lysosomes, suggesting that it is recycled between endosomes and the flagellar pocket. TbeIF2K2 location suggests a relevance in sensing protein or nutrient transport in T. brucei, an organism that relies heavily on posttranscriptional regulatory mechanisms to control gene expression in different environmental conditions. This is the first membrane-associated eIF2{alpha} kinase described in unicellular eukaryotes.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Translational regulation plays a pivotal role in stress adaptation programs in eukaryotes, from yeast to mammals (10). Little is known about translational regulation in trypanosomatids, an early diverging group of organisms in the eukaryotic lineage. Trypanosomes encompass important human pathogens, such as Trypanosoma brucei, the agent of sleeping sickness in Africa, Trypanosoma cruzi, agent of Chagas’ disease in the Americas, and Leishmania spp., the agent of the devastating disease leishmaniasis (http://www.who.int/tdr). In their digenetic lifestyle, cycling between insects and mammals, trypanosomes are subjected to the stress of encountering the different physiological milieu of their new hosts and must adapt to these environments. Most gene regulation in these organisms relies on posttranscriptional mechanisms (8). This view is largely based on (i) the fact that their mRNAs are transcribed as polycistronic RNAs that are then trans-spliced with the addition of a 5' leader sequence, (ii) the lack of well-defined RNA polymerase II promoters, and (iii) the paucity of transcriptional regulators. Several examples have been described of mRNAs translated only in a particular stage of differentiation, in a mechanism involving regulatory 3'-untranslated region sequences (16, 34, 48). General translation may be regulated during the differentiation process in T. brucei, as indicated by drastic alterations in polysome profiles (5).

One of the most conserved stress-activated regulatory pathways in eukaryotes involves the inhibition of protein synthesis through the phosphorylation of the alpha subunit of the translation initiation factor 2 (eIF2{alpha}) by a family of protein kinases that are activated by specific signals (10). eIF2, bound to GTP, delivers the initiator methionyl tRNA to the 40S ribosomal subunit in each round of translation initiation. For the formation of the 80S complex at the AUG initiator codon, GTP is hydrolyzed to GDP, with the release of eIF2-GDP. For a new cycle of initiation, GDP must be exchanged to GTP, in a process requiring the guanine exchange factor eIF2B. The phosphorylated form of eIF2 (eIF2{alpha}-P) is a poor substrate for eIF2B but has a much higher affinity for eIF2B than the unphosphorylated eIF2-GDP, acting as a competitive inhibitor.

Whereas high levels of eIF2{alpha}-P block translation, moderate levels of eIF2{alpha}-P, while still allowing protein synthesis to take place, lead to translational activation of specific messages, such as GCN4 in Saccharomyces cerevisiae (25) and ATF4 in mammals (50). These messages contain upstream open reading frames (uORFs) in their leader sequences that inhibit the scanning ribosome from reaching the main ORF. Upon a reduction in the amounts of eIF2-GTP, as a result of the phosphorylation of eIF2{alpha}, the ribosomes bypass the uORFs, and translate the main ORF. GCN4 and ATF4 are both bZIP transcriptional activators that regulate downstream responses aimed at alleviating the initial stress condition. GCN4 activates hundreds of genes involved in amino acid biosynthesis and intermediary metabolism (37). ATF4, besides regulating amino acid metabolism, also participates in other stress remedial programs (22). Thus, eIF2{alpha} phosphorylation can provide a means for both general repression of protein synthesis, as well as gene-specific translational activation.

GCN2, the sole eIF2{alpha} kinase in S. cerevisiae, is activated by amino acid deprivation and low levels of glucose or purine (24, 51). Mammals have three other eIF2{alpha} kinases in addition to GCN2: HRI, activated by the lack of heme; PKR, activated by double-stranded RNA and cytotoxic stresses; and PEK/PERK, activated by endoplasmic reticulum (ER) stresses (10, 20, 27-29, 53). Orthologs of PEK/PERK are found in Caenorhabditis elegans and Drosophila melanogaster and of HRI are found in Schizosaccharomyces pombe (44, 52). Recently, another eIF2{alpha} kinase was identified in Toxoplasma gondii that is activated under alkaline and temperature stresses (45).

Activation of these kinases is mediated by dimerization and autophosphorylation of specific residues in the catalytic region. This phosphorylation event allows the binding of the substrate (13). Activation is controlled by regulatory domains specific to each type of eIF2{alpha} kinase. For GCN2, the binding of uncharged tRNAs to a region with similarity to histidinyl tRNA synthetase (HisRS domain) promotes its activation (36, 40). In PEK/PERK, an ER transmembrane protein, the regulatory domain located in the lumen of the ER is normally bound to BiP; when unfolded proteins accumulate in the ER, BiP is released from the regulatory domain, which then dimerizes the protein, activating the cytoplasmic kinase domain (4, 32).

Given the relevance of eIF2 signaling in stress remedial programs in all eukaryotes, and the obvious relevance of posttranscriptional regulation in trypanosomatids, we approached this regulatory pathway in T. brucei. Here we describe the characterization of an eIF2{alpha} kinase of T. brucei that is a membrane-associated protein localized at the flagellar pocket. The data presented here suggest that this kinase has an important role in sensing the state of protein transport in these parasites.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Yeast strains and growth conditions. Standard yeast methods were used (42). Yeast were grown in synthetic complete medium lacking amino acids to select for plasmids and supplemented with 2% glucose or with 2% raffinose or 10% galactose. The yeast strains used in the present study were as follows: H1643 (MATa ura3-52 leu2-3,-112 trp1-{Delta}63 sui2{Delta} p1108[GCN4-lacZ] at trp1-{Delta}63 [pSUI2 URA3]) (12), H1894 (MATa ura3-52 leu2-3,-112 trp1-{Delta}63 gcn2{Delta}), J80 (MATa ura3-52 leu2-3,-112 trp1-{Delta}63 gcn2{Delta} sui2{Delta} [pSUI2 LEU2]), and J82 (MATa ura3-52 leu2-3,-112 trp1-{Delta}63 gcn2{Delta} sui2{Delta} [pSUI2S51A LEU2]) (11).

Parasite strains and growth conditions. T. brucei 427 (MITat 1.2) was used in all experiments. Procyclic forms were grown in SDM-79 medium supplemented with 10% fetal bovine serum at 28°C and bloodstream forms in HMI-9 medium supplemented with 10% fetal bovine serum and 10% Serum Plus (JRH Biosciences) at 37°C.

Cloning and plasmid constructions. Genomic DNA was isolated from T. brucei procyclic forms. PCR was performed with the indicated primers by using Taq DNA polymerase or Platinum Taq (Invitrogen). PCR products were cloned in TOPO, completely sequenced, and then transferred to the appropriate vectors. The entire coding sequence of TbeIF2{alpha} was obtained as two fragments, using the oligonucleotides BC340 (GGGGAGCTCATGGCAGCTTACGGT) and BC215R (GGGGAATTCTTCCCATGCGTGTTTACCG) for the sequence corresponding to amino acid residues 1 to 263 and oligonucleotides BC215F (GGGGGATCCTTTTATGAGGAAAAGTTACCA) and BC335 for residues 125 to 419. For expression in Escherichia coli, the complete sequence was obtained by using a ClaI site common to both fragments and introducing it into the SacI/NotI sites of pET28a(+), generating plasmid pBE495. For expression in yeast from the GAL1 promoter in a LEU2 plasmid, a EcoRI-BamHI fragment of pBM272 containing the GAL1 promoter was ligated with a BamHI-XbaI fragment of pBE495 containing the TbeIF2{alpha} sequence into the EcoRI/XbaI sites of pRS315 (43), generating plasmid pBE498. The expression of TbeIF2{alpha}125-419 in E. coli was obtained by cloning the PCR fragment from the TOPO plasmid into the BamHI/NotI sites of pET28a(+) (plasmid pBE501). For its expression from the GAL1 promoter in yeast, the NcoI(blunt)-NotI fragment from pBE501 was transferred into plasmid pBE498 digested with BamHI(blunt)-NotI, replacing the insert of the wild-type protein with the truncated one (plasmid pBE506). The construction of the mutation T169A was performed by PCR using the oligonucleotides BC215F (GGGGGATCCTTTTATGAGGAAAAGTTACCA) and BC400 (GGCACGAATGCGAATCCTAGCGATTTCCGT). The product digested with BamHI-TifI was used in a three-fragment ligation with fragment TifI-NotI from the wild-type TbeIF2{alpha}125–419 sequence and pET28a(+) linearized with BamHI-NotI (pBE520). For the expression of the mutant forms of Tb-eIF2{alpha}125-419 in yeast, the NcoI(blunt)-NotI fragment of pBE520 was cloned into pBE498 digested with BamHI(blunt)-NotI. The expression of yeast eIF2{alpha} under the control of GAL1 was obtained by transferring a BamHI-EcoRI blunted fragment from pBE280 (46) into the blunted BamHI site of pBE498. For the expression of the complete TbeIF2{alpha}T169A in E. coli, the AlwNI-NotI fragment of pBE520 and the SacI-AlwNI fragment of pBE495 were cloned into the pET28a(+) plasmid linearized with SacI-NotI, generating plasmid pBE587.

The kinase domain of TbeIF2K2 (residues 618 to 1009) was amplified with oligonucleotides BC442 (GGATCCATGCCACAACTCTTTC) and BC445 (GAATTCTCAGTTGGCTGACGG). The amplified product was transferred to pEGST (35) for expression in yeast as a fusion to glutathione S-transferase (GST) (pBE553). For raising antibodies, the putative regulatory domains of the kinases were cloned using the oligonucleotides BC436 (AAGCTTTTTCAAGTTGGAAGTCA) and BC437 (CTCGAGTTACTTCTTTCTCCG) for TbeIF2K11068-1236, BC438 (GAATTCATGCAACCATCAGGGG) and BC441 (AAGCTTTTATATTGGAATAGACTC) for TbeIF2K235-449, and BC446 (GGATCCATGGACTCTCAAAGTG) and BC450 (CTCGAGTTAATTAGAGATGTTCTC) for TbeIF2K31-476. The amplified products were transferred to pET28a(+).

The kinase domain of human PKR (amino acids 258 to 551) was transferred as a BamHI-HindIII(blunt) fragment from pC661-1 (30) into the pGEX2T plasmid linearized with BamHI-EcoRI(blunt), generating plasmid pBE527. The mouse eIF2{alpha} coding sequence was obtained from cDNA of brain total RNA by PCR with oligonucleotides BC398 (GGGGATCCATGCCGGGGCTAAGTTG) and BC399 (GGGAATTCTTAATCTTCGCTTTGGCTTCC). The amplified product was transferred to the plasmid pET28a(+), generating plasmid pBE526.

Total RNA from T. brucei was obtained by TRIzol extraction as described by the manufacturer (Invitrogen) and further purified by precipitation with 2 M LiCl. RNA was treated with DNase (1 U/µg), and 0.3 µg was used in the reaction with SuperScript One-Step RT-PCR using Platinum Taq (Invitrogen). The oligonucleotides used for the amplification of the sequences corresponding to the TbeIF2{alpha} mRNA were BC338 (AACGCTATTATTAGAACAGTTTCT) (spliced leader sequence) and BC334 (GGGTTGATGACCTTACCGATG).

Expression and purification of recombinant proteins. The soluble His6-TbeIF2{alpha} wild-type and His6-TbeIF2{alpha}T169A proteins expressed in E. coli BL21(DE3) were purified from cultures induced with 100 µM IPTG (isopropyl-ß-D-thiogalactopyranoside) at 23°C overnight on nickel chelating resin as described by the manufacturer (QIAGEN). The putative regulatory domains of the kinases TbeIF2K1, TbeIF2K2, and TbeIF2K3 fused with a N-terminal His tag were expressed in E. coli BL21(DE3). The insoluble His6-TbeIF2K11068-1236 protein was purified from cultures induced with 1 mM IPTG at 37°C for 2 h by preparative sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The insoluble His6-TbeIF2K235-449 protein was purified from cultures induced with 1 mM IPTG at 23°C overnight on nickel chelating resin as described by the resin manufacturer. The soluble His6-TbeIF2K31-476 protein was purified from cultures induced with 1 mM IPTG at 30°C overnight on nickel chelating resin. The soluble His6-eIF2{alpha} was purified from cultures induced with 400 µM IPTG at 23°C overnight. The soluble GST-PKRKD (kinase domain) was purified from cultures induced with 400 µM IPTG at 23°C overnight on glutathione-Sepharose 4B as described by the resin's manufacturer (Amersham).

Preparation of cell extracts. Yeast cell extracts were prepared by agitation with glass beads in phosphate-buffered saline (PBS) containing 2 mM benzamidine, 1 µg of leupeptin/ml, 4 µg of aprotinin/ml, 10 µg of pepstatin A/ml, 1 µg of antipaine/ml, 1 mM phenylmethylsulfonyl fluoride, 10 mM sodium pyrophosphate, and 1 mM NaF. For T. brucei, parasites (ca. 5 x 108 cells) were washed in PBS and resuspended in 150 µl of 20 mM Tris-HCl (pH 8.0)-150 mM NaCl-2 mM MgCl2-2 mM EGTA-2 mM benzamidine-1 µg of leupeptin/ml-4 µg of aprotinin/ml-10 µg of pepstatin A/ml-1 µg of antipain/ml-1 mM phenylmethylsulfonyl fluoride-10 mM sodium pyrophosphate-1 mM NaF. After freezing and thawing, the suspension was centrifuged at 10,000 x g for 15 min. The supernatant was kept as soluble material. The pellet was resuspended in 150 µl of the same buffer supplemented with 1% Triton X-100. After centrifugation at 10,000 x g for 15 min, the supernatant was kept as the membrane-enriched fraction. Final insoluble material was solubilized in buffer containing 8 M urea.

Antisera and immunoblots. Antibodies were obtained in rabbits by immunization with the recombinant proteins purified from E. coli. Monospecific antibodies to His-TbeIF2K235-449 were obtained by adsorption to the purified recombinant His-TbeIF2K235-449 protein immobilized on a nitrocellulose filter, as described previously (39). For immunoblots, membranes were blocked with 5% nonfat milk in double-distilled H2O for 1 h at 23°C, followed by incubation with primary antibodies for 1 h at 23°C or overnight at 4°C. The following conditions were used: (i) anti-TbeIF2{alpha} diluted 1:500 in PBS, (ii) purified anti-TbeIF2K235-449 diluted 1:500 in PBS, (iii) anti-(mammalian)eIF2{alpha} (Cell Signaling) diluted 1:1,000 in Tris-buffered saline (TBS)-0.1% Tween 20-5% bovine serum albumin (BSA), (iv) anti-(yeast)eIF2{alpha} (23) diluted 1:500 in PBS, (v) anti-eIF2{alpha}-P (Biosource) diluted 1:1,000 in TBS-0.1% Tween 20-5% BSA, (vi) anti-GST (laboratory reagent, 1:5,000 in PBS), and (vii) anti-TbBiP (2) diluted 1:60,000 in PBS-0.1% Tween 20-5% BSA. After washes with 0.1% Tween 20 in PBS or TBS, bound antibodies were detected by using horseradish peroxidase (HRP)-protein A (Amersham Biosciences) diluted 1:4,000 in PBS for anti-TbeIF2{alpha}, anti-TbeIF2K235-449, anti-GST, anti-(yeast)eIF2{alpha}, anti-eIF2{alpha}-P, and anti-BiP and by using HRP-conjugated goat anti-mouse immunoglobulin G (IgG; Santa Cruz Biotechnology, Inc.) diluted 1:4,000 in TBS-0.1% Tween 20-5% BSA for anti-(m)eIF2{alpha}. The bound antibodies were detected by using enhanced chemiluminescence (Amersham Biosciences). When necessary, the antibodies were stripped off the membranes by incubation with 100 mM ß-mercaptoethanol, 2% SDS, and 62.5 mM Tris-HCl (pH 6.7) at 50°C for 30 min.

Immunoprecipitation. Extract (700 µg) of induced J82 yeast strain carrying the plasmid pBE553 (GST-TbeIF2K2KD) or pEGST (GST) was precleared by incubation with 20 µl of protein A-Sepharose CL-4B beads (Amersham Biosciences) and preimmune serum in buffer containing 10 mM Tris-HCl (pH 7.5), 100 mM NaCl, 30 mM MgCl2, and 1 mM NaF. The supernatant was incubated for 2 h at 4°C with 20 µl of protein A-Sepharose beads preincubated with anti-GST antibodies. The beads were washed three times with the same buffer, and the material bound to the beads used in the in vitro kinase assays.

In vitro phosphorylation assays. Kinase assays using purified PKR or GCN2 were performed as described previously (13). Phosphorylation reactions using the immunoprecipitated GST-TbeIF2K2KD contained 30 µCi of [{gamma}-32P]ATP in buffer containing 4 mM Tris-HCl (pH 8.0), 50 mM imidazole, 120 mM NaCl, 1 mM EGTA, 1% Triton X-100, 2.5 mM MnCl2, and 2 mM magnesium acetate in a volume of 30 µl. Reactions were allowed to proceed for 1 h at 23°C. Proteins were denatured in the absence of ß-mercaptoethanol (to avoid the comigration of the IgG heavy chain and TbeIF2{alpha}), resolved by SDS-PAGE, and stained with Coomassie blue; the incorporation of radioactive phosphate into TbeIF2{alpha} was detected on a Typhoon phosphorimager.

Tomato lectin uptake and localization studies. Cultured bloodstream cells were washed with HEPES buffered-saline (50 mM HEPES, 50 mM NaCl, 5 mM KCl, 70 mM glucose [pH 7.5]) and resuspended at 107/ml in HMI9-BSA (serum-free HMI9 medium supplemented with 0.5 mg of bovine serum albumin/ml) containing tomato lectin-biotin conjugate (TL; Vector Laboratories, Burlingame, CA) at 20 µg/ml. Cells were incubated at 5°C or 15°C for 30 min, followed by extensive washing with PBS. Washed cells were lightly prefixed with 0.1% formaldehyde and then fixed onto slides with methanol-acetone as described previously (1). Cells were then stained with Alexa 633-streptavidin (Molecular Probes, Eugene, OR) to detect bound and internalized TL. At the same time cells were also stained with rabbit anti-TbeIF2K2 and/or monoclonal anti-p67 (1) to detect the lysosome. Appropriate Alexa 488- and Alexa 633-conjugated goat anti-IgG (Molecular Probes) were used as secondary antibodies. Cells were also stained with 500 ng of DAPI (4',6'-diamidino-2-phenylindole)/ml. Serial image stacks (0.2-µm Z-increment) were collected at 100x (PlanApo oil immersion 1.4 NA) on a motorized Zeiss Axioplan IIi equipped with a rear-mounted excitation filter wheel, a triple-pass (DAPI-fluorescein isothiocyanate-Texas Red) emission cube, differential interference contrast optics, and a Orca AG charge-coupled device camera (Hamamatsu, Bridgewater, NJ). All images were collected with OpenLabs 5.0 software (Improvision, Inc., Lexington, MA), and fluorescence images were deconvolved by using a constrained iterative algorithm, pseudocolored, and merged by using Velocity 4.0 software (Improvision).

Dephosphorylation and deglycosylation assays. A total of 5 µg of total protein from the membrane-enriched fraction was incubated with 20 U of calf intestinal alkaline phosphatase (Promega) in buffer containing 50 mM Tris-HCl (pH 9.3 at 25°C), 1 mM MgCl2, 100 µM ZnCl2, and 1 mM spermidine in a volume of 10 µl at 37°C for 3 h. Deglycosylation was performed with the membrane-enriched protein fraction (20 µg) of procyclic parasites, denatured at 100°C for 5 min in buffer containing 50 mM sodium phosphate (pH 5.5), 0.1% SDS, and 50 mM ß-mercaptoethanol. After incubation on ice for 10 min, endoglycosidase H (Sigma) was added to the mixture, and the reaction was allowed to proceed for 18 h at 37°C.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Trypanosomatids encode three potential eIF2{alpha} kinases. Sequences for three potential eIF2{alpha} kinases are found in the genome of T. brucei, with similar counterparts in other two trypanosomatids, Trypanosoma cruzi and Leishmania major (3, 15, 26). We named these proteins TbeIF2K1 through TbeIF2K3. The alignment of the catalytic kinase domains (KD) of the T. brucei proteins and the known eIF2{alpha} kinases is shown in Fig. 1. The three proteins contain an insert between domains IV and V, typical of eIF2{alpha} kinases (21). The inserts range from 46 residues in TbeIF2K2 to 119 in TbeIF2K3. These sizes are within the range found for the eIF2{alpha} kinases, of which the extreme is the T. gondii TgKA, composed of 615 residues. TbeIF2K3 has another large insert located between domains VIB and VII, which is unusual for this class of kinases. An interesting feature of the T. brucei proteins is the site of putative autophosphorylation. As indicated by the boxed arrow in Fig. 1, TbeIF2K2 has a serine residue where all other kinases have a threonine residue. Phosphorylation of this residue in PKR promotes the recognition of the substrate (13). The presence of the serine residue in TbeIF2K2 was confirmed by DNA sequencing. Residue T487 of PKR, indicated with a boxed arrowhead, is an important determinant of specificity for recognition of the substrate. This residue is within an {alpha}-helical domain that in eIF2{alpha} kinases is longer than in other class of kinases. This extended configuration, along with its orientation, determines the substrate specificity. This threonine is found in TbeIF2K2 and TbeIF2K3 but not in TbeIF2K1. The remaining residues that are typical of this class of kinases are for the most part conserved in the T. brucei proteins, as indicated by the arrowheads in the alignment of Fig. 1. Figure 2 depicts the putative regulatory domains of the three T. brucei kinases relative to their catalytic regions. TbeIF2K1 is apparently a GCN2 ortholog, containing a ring finger, WD repeat domain (RWD) and a HisRS-like domain, which in yeast GCN2 are involved in GCN1 and uncharged tRNA binding, respectively. The HisRS-like region of TbeIF2K1 was detected by the Phyre prediction engine (www.sbg.bio.ic.ac.uk/phyre). The domain architecture is similar to GCN2, with the RWD and HisRS-like regions flanking the kinase domain. No pseudokinase region was detected in TbeIF2K1. TbeIF2K2 and TbeIF2K3 putative regulatory domains have no similar counterparts in any database, except the other trypanosomatids orthologs. TbeIF2K2 has a predicted N-terminal signal sequence and a potential transmembrane domain, suggesting association with membranes and with a topological similarity to PEK/PERK, i.e., a type I transmembrane protein with a C-terminal cytosolic kinase domain and a large N-terminal ectoplasmic domain.


Figure 1
View larger version (81K):
[in this window]
[in a new window]

 
FIG. 1. T. brucei encodes three potential eIF2{alpha} kinases. The alignment of the catalytic domains of eIF2{alpha} kinases is shown. Identical residues are indicated in dark gray, and conserved residues are indicated in light gray. Subdomains I through XI are indicated above the sequences, as are the functional regions comprising the catalytic and activation loops. The kinase inserts between subdomains IV and V are indicated by dashes, with the number of residues in parentheses. The dots indicate conserved residues among kinases in general. Arrowheads indicate residues specific to the eIF2{alpha} kinases, with the boxed arrowhead indicating the substrate specificity determinant in PKR. The boxed arrow in subdomain VIII marks the residue in PKR that is autophosphorylated in the active protein. Sc, S. cerevisiae; Dm, D. melanogaster; Nc, N. crassa; Hs, H. sapiens; Sp, S. pombe; Rn, R. norvegicus; Tg, T. gondii; Ce, C. elegans. GeneDB accession numbers: TbK1, Tb11.02.5050; TbK2, Tb04.1H19.980; TbK3, Tb06.5F5.660. GenBank accession numbers: ScGCN2, NP_010569; DmGCN2, AAC47516; NcGCN2, CAA62973; HsGCN2, Q9P2K8; CePEK, Q19192; DmPEK, AAF61200; HsPEK, AAI26355; SpHRI, Q9UTE5; HsPKR, P19525; TgKA, AY518936.

 

Figure 2
View larger version (23K):
[in this window]
[in a new window]

 
FIG. 2. Domain organization and expression of TbeIF2 kinases. (A) Schematics of the domain organization of the TbeIF2 kinases. Amino acid residue numbers are indicated above the bars, with the residues of the kinase domains (KD) corresponding to the sequences presented in Fig. 1. In TbeIF2K1, RWD indicates the ring finger, WD domain, and HRS indicates the sequence with similarity to histidinyl-tRNA synthetase. (B) Expression of the mRNA for each kinase. RT-PCR products obtained from procyclic (P) and bloodstream (B) forms, using the oligonucleotide pairs BC436-BC437 for TbeIF2K1, BC438-BC441 for TbeIF2K2, and BC446-BC450 for TbeIF2K3, with the expected sizes of 0.5, 1.2, and 1.4 kb, respectively; the controls represent the same DNase-treated RNA preparations used for RT-PCR, subjected to PCR with the primers for TbeIF2K1. (C) Expression of TbeIF2K2. Immunoblot of whole cells of bloodstream (B) and procyclic (P) parasites with anti-His6-TbeIF2K235-449 serum or with preimmune serum; the lane labeled "c" contains the purified His6-TbeIF2K235-449 protein that was used for immunization. The arrow indicates the TbeIF2K2 protein. Molecular weight standards (103) are indicated on the left panel.

 
Reverse transcription-PCR (RT-PCR) indicated that the mRNAs encoding for the three proteins are present in both bloodstream and procyclic forms of the parasite (Fig. 2B). Antibodies were then raised against the putative regulatory regions of the three proteins. Although for TbeIF2K1 and TbeIF2K3 the antisera recognized the recombinant proteins, no clear signal was detected in immunoblots of whole-cell extracts of the parasites (data not shown). It is possible that these are very low abundance proteins or that they are only translated under specific conditions not tested here. For TbeIF2K2, the antiserum recognized a protein with an apparent molecular mass of approximately 130 to 140 kDa, slightly larger than expected (111 kDa), suggesting that it might be glycosylated (Fig. 2C). Consistent with this observation, the putative ectoplasmic domain (residues 1 to 464) contains four potential Asn-X-Ser/Thr N glycosylation sites (Asn63, -165, -217, and -444). Given the suggestive membrane localization of this protein, which would be unique among eIF2{alpha} kinases in unicellular eukaryotes, we focused this work on the characterization of TbeIF2K2.

TbeIF2K2 is localized to flagellar pocket and endosomal membranes. Indication of the membrane-bound nature of TbeIF2K2 was obtained by partial fractionation of cell extracts. Parasites were lysed in buffer lacking detergents, and the insoluble material was extracted in the same buffer containing 1% Triton X-100. As shown in Fig. 3A, virtually all TbeIF2K2 partitioned to the detergent-solubilized material. As a control, we probed the lower part of the same nitrocellulose membrane with antibodies directed against TbeIF2{alpha}, a cytoplasmic protein (see below). Endoglycosidase H treatment of the membrane enriched fraction resulted in a decrease in size of TbeIF2K2, confirming the presence of N-glycans and thus its import and transit through the ER (Fig. 3B).


Figure 3
View larger version (8K):
[in this window]
[in a new window]

 
FIG. 3. TbeIF2K2 is a glycosylated membrane associated protein. (A) Partial fractionation. Procyclic forms were lysed by freeze-thawing and centrifuged as described in Materials and Methods. The soluble supernatant was separated (lane 1); the pellet was solubilized in the same buffer containing 1% Triton X-100, in the same volume as the supernatant. After centrifugation, the supernatant was separated (lane 2), and the pellet was solubilized in the same volume of buffer containing 8 M urea (lane 3). Identical volumes of the three samples were subjected to immunoblot analysis with anti-TbeIF2K235-449 antibodies (TbK2) and with anti-TbeIF2{alpha} serum (Tb-eIF2{alpha}). (B) Endoglycosidase H treatment. Detergent-solubilized membrane fractions of procyclic parasites were treated with endoglycosidase H (+) or incubated under the same conditions without endoglycosidase H (–) and then subjected to immunoblotting with anti-TbeIF2K235-449 antibodies (TbK2).

 
Immunofluorescence analysis of T. brucei cells using affinity-purified antibodies (Fig. 4A) showed that TbeIF2K2 is highly concentrated in a structure near the kinetoplast in both procyclic and bloodstream parasites, a finding suggestive of the flagellar pocket (Fig. 4B and Fig. 5). Preincubation of the antibodies with the purified recombinant protein abolished the signal, ascertaining the specificity of the reaction (Fig. 4B, bottom panels). We then performed a colocalization analysis with TL, which labels exclusively the flagellar pocket of bloodstream parasites when intact cells are incubated at 5°C to block endocytosis (6, 41) (Fig. 5). The anti-TbeIF2K2 signal for the most part overlapped the TL spot, as shown in panels A to D, confirming the flagellar pocket localization, although weak internal labeling associated with the lysosomal marker p67 was found in some cells (panels E to H, small arrow). Seen more frequently, however, was a strong independent TbeIFK2 signal in the region between the flagellar pocket and lysosome suggestive of partial endosomal localization (Fig. 5E to H, arrowhead). To investigate this possibility, we performed a TL uptake experiment by incubation of the cells at 15°C. At this temperature, TL is internalized into endosomes but subsequent delivery to the lysosome is minimized (6). Under these conditions TbeIF2K2 again colocalized prominently with TL in the flagellar pocket, but a strong colocalization was also apparent in an internal tubular endosome compartment characteristic of the low temperature block (Fig. 5I to L and M to P). This tubular compartment did not stain with anti-p67 consistent with a block in endosome-to-lysosome trafficking (Fig. 5Q to T). These localization data taken together indicate that TbeIF2K2 is in the membrane of the flagellar pocket and that it can be recycled through the endocytic pathway.


Figure 4
View larger version (17K):
[in this window]
[in a new window]

 
FIG. 4. Localization of TbeIF2K2 in procyclic cells. (A) Affinity-purified anti-TbeIF2K235-449 antibodies. Immunoblot of membrane and soluble fractions obtained from procyclic parasites using monospecific purified antibodies used in the immunofluorescence assays. (B) Immunofluorescence of procyclic parasites. Immunofluorescence using affinity-purified anti-TbeIF2K235-449 antibodies ({alpha}TbK2), followed by anti-rabbit IgG-fluorescein isothiocyanate. Nuclei were labeled with DAPI. The specificity of the signal was ascertained by preincubation of the antibody solution with the purified His6-TbeIF2K235-449 protein, prior to addition to the cells (bottom row).

 

Figure 5
View larger version (36K):
[in this window]
[in a new window]

 
FIG. 5. Localization of TbeIF2K2 in bloodstream cells. Bloodstream trypanosomes were incubated for 30 min with biotinyl TL at 5°C to allow flagellar pocket binding (A to D and E to H) or at 15°C to allow binding and uptake into the endosomal compartment (I to L, M to P, and Q to T) as described in Materials and Methods. Fixed and permeabilized cells were then stained with fluorescent streptavidin to detect bound or internalized TL (red), and as indicated with purified anti-TbeIF2K2 antibodies ({alpha}TbK2) and or anti-p67 (middle panels). (A to H) Cells stained with anti-TbeIF2K2 (green) and anti-p67 (red). The discrete positioning of the anterior lysosome and the posterior flagellar pocket allow simultaneous imaging of these organelles in the same channel. (I to P) Cells stained with anti-TbeIF2K2 (green). (Q to T) Cells stained with anti-p67 (green). Merged DAPI/differential interference contrast images are presented in the leftmost panels with kinetoplast (k) and nucleus (n) labeled, and merged three-channel fluorescent images are presented in rightmost panels. The positions of the lysosome (Lys), endosome (Endo), and flagellar pocket (FP) are indicated. The arrowhead in panel H indicates a region of discrete TbeIF2K2 signal, presumably the endosome, that does not colocalize with the nearby flagellar pocket. Bars, 5 µm.

 
The kinase domain of TbeIF2K2 phosphorylates yeast and mammalian eIF2{alpha}. Given the unusual localization of this protein and the sequence divergence relative to other known eIF2{alpha} kinases, we studied the substrate specificity of TbeIF2K2. The putative kinase domain comprising residues 618 to 1009 (TbeIF2K2KD) was expressed in yeast as a fusion to GST, under the control of the galactose-inducible GAL1 promoter. Dimerization of eIF2{alpha} kinases is a requirement for their activation, and fusion of the kinase domain to heterologous dimerization domains, such as GST, results in a constitutively active protein, as shown for PKR and PEK/PERK (4, 47). Expression of GST-TbeIF2K2KD in strain J80, which contains the wild-type yeast eIF2{alpha} protein and lacks the chromosomal copy of GCN2, resulted in the complete inhibition of growth on medium containing galactose (Fig. 6A). When the same protein was expressed in the isogenic strain J82, in which the serine 51 residue of eIF2{alpha} is replaced by alanine, not a target for the eIF2{alpha} kinases, the cells were capable of growing on galactose (Fig. 6A). The expression of GST-TbeIF2K2KD in the J82 cells is shown in a Western blot with anti-GST antibodies (Fig. 6B). Direct evidence for the phosphorylation of eIF2{alpha} by TbeIF2K2 in strain J80 was obtained by immunoblotting total cell extracts, prepared after induction with galactose, using antibodies that specifically recognize the phosphorylated form of eIF2{alpha} (eIF2{alpha}-P) (Fig. 6C). Thus, TbeIF2K2 phosphorylates yeast eIF2{alpha} specifically at S51, therefore inhibiting translation and growth. The efficiency of phosphorylation of eIF2{alpha} by TbeIF2K2 was compared to that of PKR in in vitro phosphorylation assays. GST-TbeIF2K2KD, immunoprecipitated from the yeast J82 cell extract, and GST-PKRKD, purified from E. coli, were incubated with mammalian eIF2{alpha} purified from E. coli, and the reactions were analyzed by immunoblots with anti-eIF2{alpha}-P antibodies and normalized with the levels of total eIF2{alpha} (Fig. 6D). The amounts of the two kinases were equivalent, as judged from probing the upper portion of the membrane with anti-GST antibodies. These experiments, together with the in vivo results in yeast, indicated that TbeIF2K2 has the same ability as PKR to recognize and phosphorylate yeast or mammalian eIF2{alpha}, even though there are marked sequence divergences in the regions of these kinases that have been implicated in autophosphorylation and substrate recognition.


Figure 6
View larger version (62K):
[in this window]
[in a new window]

 
FIG. 6. TbeIF2K2 phosphorylates specifically residue Ser51 in yeast and mammalian eIF2{alpha}. (A) GST-TbeIF2K2KD (GST-TbK2) was expressed from the inducible GAL1 promoter in yeast strain J80, which contains the wild-type copy of the gene encoding eIF2{alpha}, and in strain J82, which contains the mutant eIF2{alpha}Ser51Ala. The growth of two independent transformants expressing GST-TbK2 is shown on raffinose- (left) and on galactose (right)-containing medium. As controls, the growth of the same strains expressing GST from the empty vector is shown (GST). (B) The expression of the proteins was determined by immunoblotting total cell extracts (5 µg of total protein) prepared from the same isolates as described above of strain J82 and of a strain without plasmid (Figure 6), grown on galactose, using antibodies to GST. As a control, the blot was probed with antibodies against total yeast eIF2{alpha} (eIF2{alpha}-T) after removal of the first antibodies (bottom panel). (C) The phosphorylation of the endogenous eIF2{alpha} was analyzed in strain J80 carrying the vector (GST) or the GST-TbeIF2K2KD expressing plasmid (GST-TbK2) after 4 or 8 h of induction with galactose, by immunoblotting with antibodies directed to the phosphorylated form of eIF2{alpha} (eIF2{alpha}-P) and normalized with antibodies to total eIF2{alpha} (eIF2{alpha}-T). (D) In vitro phosphorylation assays were performed with mammalian eIF2{alpha} purified from E. coli and with GST-TbeIF2K2KD immunoprecipitated from an extract of strain J82 grown in galactose, using as a control GST immunoprecipitated from the same strain carrying the empty vector. As a control for the efficiency of phosphorylation, we used GST-PKRKD purified from E. coli. Phosphorylation was detected by immunoblots with antibodies specific for eIF2{alpha}-P and normalized with antibodies against total mammalian eIF2{alpha} (eIF2-T). The amounts of the GST fusion proteins in the reactions were determined by immunoblots of the upper portion of the gel using anti-GST antibodies (GST).

 
TbeIF2K2 phosphorylates TbeIF2{alpha} at T169. Inspection of the trypanosomatid genomic database revealed an ortholog of eIF2{alpha} with conserved features with other known eIF2{alpha} sequences, as shown in the alignment in Fig. 7. Interestingly, however, in place of the residue corresponding to S51 that is phosphorylated in all eukaryotes, trypanosomatid eIF2{alpha} has a threonine residue. In addition, we noticed that the AUG codon assigned as the initiator for the three inspected trypanosomatid sequences (T. brucei, T. cruzi, and L. major) was not conserved. To ascertain the sequence of the transcript, we performed RT-PCR from total mRNA of T. brucei using as a forward primer an oligonucleotide corresponding to the spliced leader sequence and as a reverse primer an oligonucleotide complementary to a conserved region, located just after the putative threonine residue (T169) corresponding to S51 of other eukaryotes. Sequencing of this fragment confirmed the threonine residue and the extension in the N-terminal region in the T. brucei eIF2{alpha} (TbeIF2{alpha}), with no homology to any eukaryotic sequence, except the other trypanosomatids’ orthologs (Fig. 7A). Using the same experimental approach, we determined that these features were also found in the T. cruzi eIF2{alpha} protein (data not shown). To determine whether this extended protein was expressed in T. brucei, we raised antibodies against TbeIF2{alpha}. The only protein recognized by the antiserum has the expected size of the extended eIF2{alpha} (Fig. 7B). The difference in size between the endogenous and the recombinant protein used as control is due to the presence of the His tag sequence in the latter.


Figure 7
View larger version (22K):
[in this window]
[in a new window]

 
FIG. 7. eIF2{alpha} in trypanosomatids. (A) Alignment of the N-terminal half of T. brucei and L. major eIF2{alpha} and other characterized eIF2{alpha} proteins. A line above the sequences indicates the unstructured loop encompassing the phosphorylated residue, indicated with an arrowhead. The structural domains of eIF2{alpha} are indicated with lines below the sequences. (B) Immunoblot of total cell extract of intact bloodstream (B) and procyclic (P) form parasites using anti-TbeIF2{alpha} serum; as a control, the lane labeled rTb2{alpha} contains the His6-TbeIF2{alpha} protein purified from E. coli.

 
Given the unusual features of TbeIF2{alpha}, we then addressed whether this protein could substitute for the yeast counterpart and be a substrate for the known eIF2{alpha} kinases. The complete TbeIF2{alpha} sequence was cloned under the control of the GAL1 promoter, in a LEU2 vector. This plasmid was used to transform yeast strain H1643, which has a deletion of the chromosomal copy of the SUI2 gene, encoding eIF2{alpha}, and is maintained viable by the presence of the SUI2 gene in a URA3 plasmid. This strain is unable to grow in the presence of 5-fluoroorotic acid (5-FOA), which selects for Ura cells arising from the spontaneous loss of the URA3 plasmid and therefore of the SUI2 gene. As a control, we used a LEU2 plasmid expressing yeast eIF2{alpha} from the same promoter. The expression of TbeIF2{alpha} did not allow growth in 5-FOA, indicating that TbeIF2{alpha} cannot functionally substitute for the yeast eIF2{alpha} (Fig. 8A). Because the presence of the N-terminal extension could hinder the function of TbeIF2{alpha} in yeast, we performed the same assay using a truncated form of the protein (TbeIF2{alpha}125-419). This truncated protein was functional in yeast, allowing the growth of yeast cells on 5-FOA-containing medium (Fig. 8A). Immunoblots of total cell extracts prepared from independent isolates from the 5-FOA plates showed that TbeIF2{alpha}125-419 was the sole eIF2{alpha} present in these cells (Fig. 8B).


Figure 8
View larger version (28K):
[in this window]
[in a new window]

 
FIG. 8. TbeIF2{alpha} substitutes for yeast eIF2{alpha}. (A) Growth of yeast cells expressing TbeIF2{alpha}. Derivatives of strain H1643 expressing the indicated eIF2{alpha} proteins from the GAL1 promoter were grown on plates containing synthetic medium supplemented with galactose in the presence or absence of 5-FOA. (B) Expression of TbeIF2{alpha}125-419 in yeast. Total cell extracts (50 µg) of two isolates carrying TbeIF2{alpha}125-419 and one isolate expressing yeast eIF2{alpha} selected from the 5-FOA plates and of control H1643 cells carrying only the vector were subjected to immunoblotting with anti-TbeIF2{alpha} serum; after stripping the first antibodies, the same membrane was incubated with antibodies against yeast eIF2{alpha}. The bottom panel shows the filter stained with Ponceau S.

 
We next addressed whether TbeIF2{alpha} was a substrate for yeast GCN2 by assessing the growth of these isolates on media containing 3-aminotriazole. The isolates expressing either TbeIF2{alpha}125-419 or TbeIF2{alpha}125-419(T169A) were capable of growth on 3-aminotriazole (data not shown). This is probably due to the formation of a defective ternary complex. Thus, an in vivo assay for GCN2-mediated phosphorylation of TbeIF2{alpha}125-419 was not possible. In vitro phosphorylation assays were then performed with purified TbeIF2{alpha}, PKR, and GCN2. The complete TbeIF2{alpha}, purified from E. coli as a His tag fusion, was incubated with purified PKR or GNC2 in the presence of [33P]ATP. TbeIF2{alpha} was not phosphorylated by GCN2 and only weakly phosphorylated by PKR (Fig. 9). The truncated eIF2{alpha}125-419 protein was not phosphorylated by PKR or GCN2 either (data not shown). To address whether TbeIF2{alpha} was a substrate for TbeIF2K2, GST-TbeIF2K2KD was immunoprecipitated from extracts of strain J82 grown on galactose, using anti-GST antibodies, and used in in vitro phosphorylation assays with purified TbeIF2{alpha} or TbeIF2{alpha}T169A. TbeIF2K2 was capable of phosphorylating T. brucei eIF2{alpha} but not the mutant protein TbeIF2{alpha}T169A (Fig. 9). These results clearly show that TbeIF2K2 phosphorylates TbeIF2{alpha} specifically at T169. Thus, TbeIF2K2 recognizes yeast, mammalian, and trypanosomatid eIF2{alpha}, but TbeIF2{alpha} is only efficiently recognized by the trypanosomatid kinase.


Figure 9
View larger version (24K):
[in this window]
[in a new window]

 
FIG. 9. In vitro phosphorylation of TbeIF2{alpha}. Purified His6-TbeIF2{alpha} was used in in vitro reactions with purified GCN2 (left panels) and purified PKR (upper right panels) and with immunoprecipitated GST-TbeIF2K2KD (bottom right panels). Controls were purified yeast GST-eIF2{alpha} and GST-eIF2{alpha}Ser51Ala for the GCN2 and PKR assays and purified His6-TbeIF2{alpha}Thr169Ala for the TbeIF2K2 assay. Exposure times are indicated as "short" or "long." The total protein was visualized on the gels by Coomassie R250 stain.

 
Modifications of TbeIF2K2 in bloodstream forms. Two bands corresponding to TbeIF2K2 can be detected on prolonged runs on SDS-7% PAGE of membrane-enriched fractions from bloodstream parasites obtained under normal growth conditions in well-established medium, whereas only one band is seen for procyclics (Fig. 10A). The procyclic protein migrates in a position intermediary between the two bands observed in the bloodstream forms. In analogy to PEK/PERK, which shows a drastic change in migration due to phosphorylation when activated, we reasoned that in the bloodstream forms TbeIF2K2 could be partially activated. To determine whether the slower-migrating protein was phosphorylated, the membrane-enriched fractions were treated with alkaline phosphatase. As shown in Fig. 10, the phosphatase treatment caused a shift of the bloodstream protein to the faster mobility band. In contrast, in procyclics the phosphatase treatment did not alter the mobility of the protein. Thus, in bloodstream forms, a fraction of the TbeIF2K2 protein is phosphorylated under normal in vitro growth conditions. Whether the phosphorylated form of TbeIF2K2 found in bloodstream parasites represents the activated form of the kinase remains to be elucidated.


Figure 10
View larger version (20K):
[in this window]
[in a new window]

 
FIG. 10. Modifications of TbeIF2K2 in bloodstream parasites. (A) Phosphorylation of TbeIF2K2. Membrane-enriched (mb) and soluble (sol) fractions (5 µg of total protein) of bloodstream (B) and procyclic (P) parasites were subjected to immunoblots with anti-TbeIF2K2 antibodies and with anti-BiP serum (left panels) (BiP partitions to both soluble and membrane enriched fractions). Membrane-enriched fractions from bloodstream (B) and procyclic (P) parasites were treated with calf intestinal alkaline phosphatase (CIAP), and subjected to immunoblot with anti-TbeIF2K2 antibodies (right panel). (B) TbeIF2K2 in high-density cultures of bloodstream forms. Membrane (mb) and soluble (sol) fractions (10 µg of total protein) from bloodstream forms grown to late logarithmic phase (2.4 x 106 cells/ml), and 12 h (2.0 x 106 cells/ml) or 24 h (4.0 x 105 cells/ml) later were subjected to immunoblotting with anti-TbeIF2K2 antibodies (TbK2) or anti-BiP (BiP) serum. The indicated number of cells corresponds to live parasites as determined by their motility at each time point.

 
Bloodstream forms are highly sensitive to high cell densities in culture. While pleomorphic strains differentiate from slender to stumpy forms above a critical density, the monomorphic strain MITat 1.2 used in the present study rapidly die (49). During the present study we found that TbeIF2K2 is affected by the density of the culture of bloodstream forms. Membrane and soluble fractions prepared from parasites obtained from culture samples taken at 12-h intervals, starting from a density of 2.4 x 106 cells/ml were analyzed in immunoblots for TbeIF2K2. As shown in Fig. 10B, TbeIF2K2 is virtually absent in parasites obtained from the culture in which cell death was evident. As a control, BiP expression was not affected, as shown by probing the same filter with anti-BiP antibodies. These results suggest that TbeIF2K2 may be subject to either downregulation of expression and/or to proteolytic degradation under these conditions.


    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We described here two highly unusual components of translational regulation found in T. brucei that seem to be conserved in T. cruzi and L. major. Considering that these organisms represent a deeply rooted branch of the eukaryotic kingdom, it is interesting that trypanosomatids have evolved an eIF2{alpha} subunit that is divergent from all other eukaryotes, regarding both the threonine residue in place of Ser51 and the unique N-terminal extension. Perhaps most surprising was the discovery of an eIF2{alpha} kinase that is membrane associated and completely constrained to a subcellular structure that is typical of this group of protozoa. Importantly, the data presented here clearly indicated that TbeIF2K2 is a kinase that phosphorylates eIF2{alpha} in a highly specific manner. Its substrate range, however, differs from the known eIF2{alpha} kinases. Although TbeIF2K2 was capable of phosphorylating yeast, mammalian, and the T. brucei eIF2{alpha}, neither PKR nor GCN2 efficiently phosphorylated TbeIF2{alpha} in vitro. This difference is not due to the presence in TbeIF2{alpha} of a threonine in the position corresponding to serine 51 since both PKR and GCN2 can phosphorylate yeast or mammalian eIF2{alpha} at a threonine residue in place of S51 (31). The specificity of substrate recognition by PKR is given by a contiguous surface on one face of eIF2{alpha} comprising the S51 region; the kinase determinants G30, A31, and Met44; and the invariant peripheral docking site comprised by the KGYID motif, located 28 residues C terminal to the S51 residue (9). Of these, only residues G30 and M44 differ in the trypanosomatids’ protein, being replaced by serine and isoleucine, respectively. Mutations in both G30 and M44 abolish phosphorylation of eIF2{alpha} by PKR (14). These substitutions alone could then account for the poor ability of TbeIF2{alpha} to function as a substrate for PKR. However, other divergent residues in TbeIF2{alpha} in positions that are invariant in other eIF2{alpha} in this critical region may also hinder its recognition by PKR. TbeIF2K2 phosphorylation of mammalian, yeast, and T. brucei eIF2{alpha} suggests that the substrate-binding sites on this kinase can accommodate a wider range of residues.

Phosphorylation of eIF2{alpha} appears to be relevant as a mechanism of regulation of protein synthesis in these parasites as suggested by the existence of three eIF2{alpha} kinases, one of which we have clearly shown to be a bona fide eIF2{alpha} kinase, and by the presence of orthologs of the five subunits of the GTP exchange factor, eIF2B, of which the regulatory subunits {alpha}, ß, and {delta} mediate the inhibitory effect caused by increased levels of eIF2{alpha}-P in the cells. It is not clear at the moment whether the phosphorylation of TbeIF2{alpha} would result in a downstream regulatory signaling cascade, since there is an apparent lack of transcriptional factors of the bZIP type in trypanosomatids that could function as GCN4 or ATF4 (26). It seems then that this signaling may only involve the downregulation of general translation during specific situations. It is possible that proteins with no transcriptional role might be translated from messages containing uORFs when TbeIF2{alpha} is phosphorylated.

The predicted domain structure of TbeIF2K2 suggests that it is an integral membrane protein with an N-terminal luminal or ectoplasmic domain and a C-terminal cytoplasmic kinase domain. Our findings that it requires detergent for solubilization and that it is N glycosylated are consistent with this interpretation. Surprisingly, however, given its topological similarity to the metazoan ER kinase PEK/PERK, TbeIF2K2 is prominently localized to the flagellar pocket and closely associated endosomal membranes. The flagellar pocket localization was also confirmed by immunofluorescence assays with different antibodies raised against another region of the protein, encompassing the kinase domain (data not shown). The flagellar pocket is the only site where endocytosis and exocytosis occur in these parasites, and all proteins destined to the plasma membrane are directed to the flagellar pocket before reaching the parasite surface (19). Trypanosomes have a dense extracellular surface coat composed of variant surface glycoprotein that restricts macromolecular access to the plasma membrane; thus, the flagellar pocket functions as the primary portal for cross talk with the host. In this regard the predicted topology of TbeIF2K2, with a cytoplasmic kinase domain and a potential extracellular regulatory domain, is very suggestive of a role in sensory signaling. A limited repertoire of transmembrane proteins have been characterized in the general endomembrane system of bloodstream trypanosomes, including the lysosomal marker p67 (1), the endosomal marker membrane-bound acid phosphatase (17), and the invariant surface glycoproteins ISG65/75, which recycle between the endosome and cell surface (7). However, none of these is likely to have a role in sensory signaling. Bloodstream trypanosomes do have a flagellar membrane-associated adenylate cyclase with an architecture analogous to that of TbeIF2K2 and that is primarily localized to the flagellum membrane, but ligands for this potential receptor have never been identified (38).

Just what process may regulate TbeIF2K2 activity is currently uncertain, but its localization in the flagellar pocket suggests as one possibility the endocytic cargo load, which is greatly enhanced in the bloodstream stage of the life cycle (18). TbeIF2K2 is constitutively expressed but has a higher basal phosphorylation state in bloodstream parasites, and perhaps this regulates kinase activity which could, in turn, control endocytosis indirectly through translational attenuation of proteins destined to the cell membrane. Another possibility is that TbeIF2K2 activity is regulated during life cycle differentiation. In natural infections pleomorphic bloodstream parasites differentiate in a density-dependent manner from dividing long slender forms to nondividing short stumpy forms that are preadapted for transmission to the tsetse fly (33). Concomitant with this growth arrest phenotype, levels of protein synthesis drop dramatically (5). This "quorum-sensing" process is stimulated by a parasite-derived small molecule called stumpy induction factor (SIF) (49). Neither SIF nor its receptor have been identified, but the location of TbeIF2K2 and its ability to phosphorylate endogenous eIF2 and thereby regulate translation make it an attractive candidate receptor. The loss of TbeIF2K2 in high-density cultures of monomorphic bloodstream trypanosomes, which are resistant to SIF, may be related as a cause or a consequence to this process.

Another issue raised by our study is how an eIF2{alpha} kinase present exclusively in a particularly small area of the cell could regulate general translation. Protein synthesis in T. brucei is not restricted to any region of the cell, since ribosomes are spread in the cytoplasm, as seen in many published electron microscopy analysis. TbeIF2{alpha} is also found distributed in the cytoplasm, as judged by immunofluorescence analysis using the antibodies described here (data not shown). We can foresee two possibilities: (i) TbeIF2K2 may regulate localized protein synthesis in the vicinity of the flagellar pocket, or (ii) activated TbeIF2K2 may change cellular localization, for example, by being internalized via endocytic vesicles, with the catalytic domain thus gaining access to a large pool of cytoplasmic eIF2{alpha}. This latter mechanism could perhaps account for the fraction of TbeIF2K2 found in endosomes and that found phosphorylated in bloodstream cells.

The N-terminal ectoplasmic domain of TbeIF2K2 that may serve a regulatory function is conserved in the orthologs of other trypanosomatids. It shares 31 and 24% identity (45 and 38% similarity) with eIF2K2 from T. cruzi and L. major, respectively. The T. cruzi protein is very similar to TbeIF2K2, containing a signal sequence at its N terminus and a transmembrane region in the exact same position as in the T. brucei protein. For the Leishmania protein, although clearly similar to TbeIF2K2 within the regulatory region, there are several inserts relative to TbeIF2K2. In addition, the signal sequence starts at residue 40, which may not qualify it for directing the protein to the membrane. It will certainly be interesting to localize the eIF2K2 proteins in the cells of both T. cruzi and L. major since these parasites seem to present slightly distinct exo- and endocytic systems relative to the better characterized membrane network described for T. brucei. The putative regulatory N-terminal domain does not show any sequence similarity with PEK/PERK or with any other known or predicted protein, including those of other parasites such as Plasmodium, Toxoplasma, Trichomonas, and Giardia. These observations taken together indicate that this kinase evolved only in the trypanosomatid lineage, but within it, it has somewhat diverged, perhaps reflecting differences in life cycles and cell biology.


    ACKNOWLEDGMENTS
 
We thank Ronald Wek (University of Indiana) for helpful discussions.

This study was supported by grants from Fundação de Amparo 'a Pesquisa no Estado de São Paulo (FAPESP) to B.A.C. and to S.S. and by National Institutes of Health grants AI056866 and AI35739 to J.D.B. M.C.S.M. and T.C.L.J. were supported by doctoral fellowships, and N.N.H. and V.S.A. were supported by postdoctoral fellowships from FAPESP.


    FOOTNOTES
 
* Corresponding author. Mailing address: Departamento de Microbiologia, Imunologia e Parasitologia, Universidade Federal de São Paulo, Rua Botucatu, 862, São Paulo, SP 04023-062, Brazil. Phone: (55)(11) 5576-4537. Fax: (55)(11) 5572-4711. E-mail: bacastilho{at}unifesp.br Back

{triangledown} Published ahead of print on 14 September 2007. Back


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Alexander, D. L., K. J. Schwartz, A. E. Balber, and J. D. Bangs. 2002. Developmentally regulated trafficking of the lysosomal membrane protein p67 in Trypanosoma brucei. J. Cell Sci. 115:3253-3263.[Abstract/Free Full Text]
  2. Bangs, J. D., L. Uyetake, M. J. Brickman, A. E. Balber, and J. C. Boothroyd. 1993. Molecular cloning and cellular localization of a BiP homologue in Trypanosoma brucei: divergent ER retention signals in a lower eukaryote. J. Cell Sci. 105:1101-1113.[Abstract]
  3. Berriman, M., E. Ghedin, C. Hertz-Fowler, G. Blandin, H. Renauld, D. C. Bartholomeu, N. J. Lennard, E. Caler, N. E. Hamlin, B. Haas, U. Bohme, L. Hannick, M. A. Aslett, J. Shallom, L. Marcello, L. Hou, B. Wickstead, U. C. Alsmark, C. Arrowsmith, R. J. Atkin, A. J. Barron, F. Bringaud, K. Brooks, M. Carrington, I. Cherevach, T. J. Chillingworth, C. Churcher, L. N. Clark, C. H. Corton, A. Cronin, R. M. Davies, J. Doggett, A. Djikeng, T. Feldblyum, M. C. Field, A. Fraser, I. Goodhead, Z. Hance, D. Harper, B. R. Harris, H. Hauser, J. Hostetler, A. Ivens, K. Jagels, D. Johnson, J. Johnson, K. Jones, A. X. Kerhornou, H. Koo, N. Larke, S. Landfear, C. Larkin, V. Leech, A. Line, A. Lord, A. Macleod, P. J. Mooney, S. Moule, D. M. Martin, G. W. Morgan, K. Mungall, H. Norbertczak, D. Ormond, G. Pai, C. S. Peacock, J. Peterson, M. A. Quail, E. Rabbinowitsch, M. A. Rajandream, C. Reitter, S. L. Salzberg, M. Sanders, S. Schobel, S. Sharp, M. Simmonds, A. J. Simpson, L. Tallon, C. M. Turner, A. Tait, A. R. Tivey, S. Van Aken, D. Walker, D. Wanless, S. Wang, B. White, O. White, S. Whitehead, J. Woodward, J. Wortman, M. D. Adams, T. M. Embley, K. Gull, E. Ullu, J. D. Barry, A. H. Fairlamb, F. Opperdoes, B. G. Barrell, J. E. Donelson, N. Hall, C. M. Fraser, et al. 2005. The genome of the African trypanosome Trypanosoma brucei. Science 309:416-422.[Abstract/Free Full Text]
  4. Bertolotti, A., Y. Zhang, L. M. Hendershot, H. P. Harding, and D. Ron. 2000. Dynamic interaction of BiP and ER stress transducers in the unfolded-protein response. Nat. Cell Biol. 2:326-332.[CrossRef][Medline]
  5. Brecht, M., and M. Parsons. 1998. Changes in polysome profiles accompany trypanosome development. Mol. Biochem. Parasitol. 97:189-198.[CrossRef][Medline]
  6. Brickman, M. J., J. M. Cook, and A. E. Balber. 1995. Low temperature reversibly inhibits transport from tubular endosomes to a perinuclear, acidic compartment in African trypanosomes. J. Cell Sci. 108:3611-3621.[Abstract]
  7. Chung, W. L., M. Carrington, and M. C. Field. 2004. Cytoplasmic targeting signals in transmembrane invariant surface glycoproteins of trypanosomes. J. Biol. Chem. 279:54887-54895.[Abstract/Free Full Text]
  8. Clayton, C. E. 2002. Life without transcriptional control? From fly to man and back again. EMBO J. 21:1881-1888.[CrossRef][Medline]
  9. Dar, A. C., T. E. Dever, and F. Sicheri. 2005. Higher-order substrate recognition of eIF2{alpha} by the RNA-dependent protein kinase PKR. Cell 122:887-900.[CrossRef][Medline]
  10. Dever, T. E. 2002. Gene-specific regulation by general translation factors. Cell 108:545-556.[CrossRef][Medline]
  11. Dever, T. E., J. J. Chen, G. N. Barber, A. M. Cigan, L. Feng, T. F. Donahue, I. M. London, M. G. Katze, and A. G. Hinnebusch. 1993. Mammalian eukaryotic initiation factor 2 alpha kinases functionally substitute for GCN2 protein kinase in the GCN4 translational control mechanism of yeast. Proc. Natl. Acad. Sci. USA 90:4616-4620.[Abstract/Free Full Text]
  12. Dever, T. E., R. C. Wek, L. Feng, A. M. Cigan, T. F. Donahue, and A. G. Hinnebusch. 1992. Phosphorylation of initiation factor 2{alpha} by protein kinase GCN2 mediates gene-specific translational control of GCN4 in yeast. Cell 68:585-596.[CrossRef][Medline]
  13. Dey, M., C. Cao, A. C. Dar, T. Tamura, K. Ozato, F. Sicheri, and T. E. Dever. 2005. Mechanistic link between PKR dimerization, autophosphorylation, and eIF2{alpha} substrate recognition. Cell 122:901-913.[CrossRef][Medline]
  14. Dey, M., B. Trieselmann, E. G. Locke, J. Lu, C. Cao, A. C. Dar, T. Krishnamoorthy, J. Dong, F. Sicheri, and T. E. Dever. 2005. PKR and GCN2 kinases and guanine nucleotide exchange factor eukaryotic translation initiation factor 2B (eIF2B) recognize overlapping surfaces on eIF2{alpha}. Mol. Cell. Biol. 25:3063-3075.[Abstract/Free Full Text]
  15. El-Sayed, N. M., P. J. Myler, D. C. Bartholomeu, D. Nilsson, G. Aggarwal, A. N. Tran, E. Ghedin, E. A. Worthey, A. L. Delcher, G. Blandin, S. J. Westenberger, E. Caler, G. C. Cerqueira, C. Branche, B. Haas, A. Anupama, E. Arner, L. Aslund, P. Attipoe, E. Bontempi, F. Bringaud, P. Burton, E. Cadag, D. A. Campbell, M. Carrington, J. Crabtree, H. Darban, J. F. da Silveira, P. de Jong, K. Edwards, P. T. Englund, G. Fazelina, T. Feldblyum, M. Ferella, A. C. Frasch, K. Gull, D. Horn, L. Hou, Y. Huang, E. Kindlund, M. Klingbeil, S. Kluge, H. Koo, D. Lacerda, M. J. Levin, H. Lorenzi, T. Louie, C. R. Machado, R. McCulloch, A. McKenna, Y. Mizuno, J. C. Mottram, S. Nelson, S. Ochaya, K. Osoegawa, G. Pai, M. Parsons, M. Pentony, U. Pettersson, M. Pop, J. L. Ramirez, J. Rinta, L. Robertson, S. L. Salzberg, D. O. Sanchez, A. Seyler, R. Sharma, J. Shetty, A. J. Simpson, E. Sisk, M. T. Tammi, R. Tarleton, S. Teixeira, S. Van Aken, C. Vogt, P. N. Ward, B. Wickstead, J. Wortman, O. White, C. M. Fraser, K. D. Stuart, and B. Andersson. 2005. The genome sequence of Trypanosoma cruzi, etiologic agent of Chagas disease. Science 309:409-415.[Abstract/Free Full Text]
  16. Engstler, M., and M. Boshart. 2004. Cold shock and regulation of surface protein trafficking convey sensitization to inducers of stage differentiation in Trypanosoma brucei. Genes Dev. 18:2798-2811.[Abstract/Free Full Text]
  17. Engstler, M., F. Weise, K. Bopp, C. G. Grunfelder, M. Gunzel, N. Heddergott, and P. Overath. 2005. The membrane-bound histidine acid phosphatase TbMBAP1 is essential for endocytosis and membrane recycling in Trypanosoma brucei. J. Cell Sci. 118:2105-2118.[Abstract/Free Full Text]
  18. Field, M. C., and M. Carrington. 2004. Intracellular membrane transport systems in Trypanosoma brucei. Traffic 5:905-913.[CrossRef][Medline]
  19. Gull, K. 2003. Host-parasite interactions and trypanosome morphogenesis: a flagellar pocketful of goodies. Curr. Opin. Microbiol. 6:365-370.[CrossRef][Medline]
  20. Han, A. P., C. Yu, L. Lu, Y. Fujiwara, C. Browne, G. Chin, M. Fleming, P. Leboulch, S. H. Orkin, and J. J. Chen. 2001. Heme-regulated eIF2{alpha} kinase (HRI) is required for translational regulation and survival of erythroid precursors in iron deficiency. EMBO J. 20:6909-6918.[CrossRef][Medline]
  21. Hanks, S. K., and T. Hunter. 1995. Protein kinases 6. The eukaryotic protein kinase superfamily: kinase (catalytic) domain structure and classification. FASEB J. 9:576-596.[Abstract]
  22. Harding, H. P., Y. Zhang, H. Zeng, I. Novoa, P. D. Lu, M. Calfon, N. Sadri, C. Yun, B. Popko, R. Paules, D. F. Stojdl, J. C. Bell, T. Hettmann, J. M. Leiden, and D. Ron. 2003. An integrated stress response regulates amino acid metabolism and resistance to oxidative stress. Mol. Cell 11:619-633.[CrossRef]