| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Previous Article | Next Article ![]()
Eukaryotic Cell, November 2007, p. 2102-2111, Vol. 6, No. 11
1535-9778/07/$08.00+0 doi:10.1128/EC.00266-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Departamento de Microbiología y Genética, Instituto de Microbiología Bioquímica, Universidad de Salamanca/CSIC, Campus Miguel de Unamuno, 37007 Salamanca, Spain
Received 25 July 2007/ Accepted 5 September 2007
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Whereas most prokaryotes, microbial eukaryotes, and plants are able to biosynthesize folate de novo, mammals have lost this capacity, and they therefore rely on its dietary ingestion to meet their metabolic needs. Accordingly, mammals have evolved highly sophisticated uptake processes for transporting folates into cells, the reduced folate carrier being the primary route for the entry of reduced folates (28). The absence in mammals of a folate biosynthetic pathway has provided the basis for the development of antifolate sulfa drugs such as sulfonamides and sulfones, which deplete pathogenic microbial cells of essential growth folate (38).
The study of the folate biosynthetic pathway has been restricted to a few species of bacteria and plants (4, 5, 15). The folate molecule is tripartite, comprising of pteridine, glutamate, and p-aminobenzoate (PABA) moieties. In Escherichia coli, folic acid is biosynthesized by coupling of PABA and 7,8-dihydro-6-hydroxymethylpterin pyrophosphate to produce 7,8-dihydropteroate, which is subsequently glutamylated to give 7,8-dihydrofolate and reduced to yield tetrahydrofolate. The PABA moiety is synthesized in two steps catalyzed by two separate enzymes (Fig. 1). In bacteria, aminodeoxychorismate synthase (a heterodimeric enzyme formed by the association of the subunits encoded in E. coli by pabA and pabB) synthesizes 4-amino-4-deoxychorismate (ADC) from chorismate and glutamine (15). However, the pathway leading to PABA in Saccharomyces cerevisiae has not yet been completely elucidated. A bifunctional gene (ABZ1) encodes a protein bearing similarity to the two components (PabA and PabB) of ADC synthase described for E. coli (9). However, the gene that presumably encodes ADC lyase in yeast remains to be identified. Based on a large-scale screening of yeast mutants hypersensitive to the toxic PABA-analogue sulfanilamide, we identified a gene of previously unknown function (YMR289w/ABZ2) that is required for the biosynthesis of PABA. Here we show that the enzyme encoded by ABZ2 is needed to convert ADC to PABA. On the basis of sequence similarity, the product of ABZ2 is representative of a group of relatively homologous ADC lyases from fungi that are distantly related to the prokaryotic and plant enzymes. This finding completes the identification of the 10 enzymatic steps that convert PABA and GTP into tetrahydrofolate in the pathway for vitamin B9 biosynthesis in yeast.
|
| MATERIALS AND METHODS |
|---|
|
|
|---|
yeast deletion strains derived from parental strain BY4742 (MAT
his3
1 leu2
0 lys2
0 ura3
0) was obtained from Euroscarf (Frankfurt, Germany; http://web.uni-frankfurt.de/fb15/mikro/euroscarf/index.html), while the essential heterozygous diploids set was obtained from Invitrogen (catalog no. 95401.H5R3). The deletion strains were generated by the Saccharomyces Genome Deletion Project (http://www-sequence.stanford.edu/group/yeast_deletion_project/deletions3.html) by replacing the target gene with a kanamycin resistance cassette, KanMX4, by means of a PCR-based gene disruption strategy (44). Yeast strains were grown on standard rich medium YPD (1% yeast extract, 2% Bacto peptone, 2% glucose) and synthetic minimal medium (SMM) (43) supplemented with the nutritional requirements of the parental strain. Agar (2%) was added for solid plates. All yeast cultures were incubated at 28°C.
Large-scale sulfanilamide sensitivity screenings. Approximately 4,800 haploid deletion strains in the BY4742 background and 1,100 heterozygous essential diploids were screened for hypersensitivity to sulfanilamide in liquid SMM. The strains were pinned from 96-well frozen stock plates by using a stainless steel 96-pin replicator (Nalgene Nunc International) into 96-well plates containing 150 µl of liquid YPD medium supplemented with G418 (150 µg/ml; Gibco-BRL). Several replicates of the corresponding wild-type strain were included in the master plates to minimize experimental noise due to intra- and interexperimental variations. The plates were incubated at 28°C for 3 days and then pin-replicated onto liquid SMM 96-well plates containing either no drug or 200 µg of sulfanilamide (Sigma)/ml. Plates were incubated at 28°C, and growth was scored quantitatively every 24 h over a period of 5 days by obtaining readings of the optical density at 595 nm, using a microplate reader spectrophotometer (model 550; Bio-Rad Laboratories). Putative sulfanilamide-hypersensitive strains identified during the screening of the yeast knockout collection were further retested at least in duplicate under the same conditions described for the screenings. Strains with enhanced sensitivity to sulfanilamide were selected based on a growth inhibition (GI), after 96 h of sulfanilamide treatment, of >75%. The GI was calculated according to the following equation: GI = 100 x [(growth of mutant in control medium - growth of mutant in drug-containing medium/growth of mutant in control medium)].
Functional complementation assays.
For complementation assay of the E. coli PabC function, a pabC deletion mutant was constructed in the E. coli strain BW25113 background according to published procedures (8). Briefly, a pabC deletion cassette was constructed by using the N-terminal pabC deletion primer (5'-CCGTAGTGAACATGCTGCCACACTAACAATTCTCTGATAAGGAG CCGGTCGGATCCCCGGGTAATTAA-3') and the C-terminal pabC deletion primer (5'- CCCAGTACCACCAGCAATAACAAGATTATCAATAACACTTTTTTCATGATGAATTCGAGCTCGTTTAA-3') to amplify the loxP-kanMX-loxP module that confers kanamycin resistance in E. coli (17). The deletion primers were designed to contain 49-nucleotide homology extensions and 19-nucleotide priming sequences for pUG6 as a template. The
1,500-bp PCR product was purified and then electrotransformed into E. coli strain BW25113 carrying the
Red expression plasmid pIJ790 (19). After primary selection on medium containing kanamycin (50 µg/ml), mutants were maintained on medium without antibiotic. They were colony-purified once nonselectively at 37°C and then checked for chloramphenicol sensitivity (25 µg/ml) to test for the loss of the helper pIJ790 plasmid. A number of kanamycin-resistant, chloramphenicol-sensitive transformants were also found to be PABA auxotrophs. One of them, JR3125 (
pabC), was selected and confirmed by analytical PCR and sequencing to carry the desired deletion.
E. coli JR3125 (
pabC) was transformed with YEp352 (20) or a YEp352-based plasmid containing an insert spanning the complete ABZ2 coding sequence and 329 and 441 bp of the upstream and downstream regions, respectively. Complementation growth tests were done by culture at 37°C in liquid M9 minimal medium containing 50 µg of kanamycin/ml and 100 µg of ampicillin/ml, with or without 200 ng of PABA/ml, and measuring the absorbance at different time intervals.
Expression and purification of Abz2p. To express the full-length Abz2 protein, a plasmid was generated by inserting the S. cerevisiae ABZ2 coding sequence (PCR amplified) between the NdeI and BamHI cloning sites of the pET-28b expression plasmid (Novagen). In the recombinant vector (pET28b-Abz2), the Abz2 polypeptide is fused in frame with an N-terminal peptide containing six tandem histidine residues, and expression of the His-tagged protein is driven by a T7 RNA polymerase promoter. The DNA sequence of the insert was confirmed.
The pET28b-Abz2 recombinant plasmid was transformed into E. coli BL21(DE3), and a 1,000-ml culture of E. coli BL21(DE3)/pET28b-Abz2 was grown at 37°C in Luria-Bertani medium containing 50 µM pyridoxal phosphate and 30 µg of kanamycin/ml until achieving an A600 of 0.8. The culture was adjusted to 0.4 mM IPTG (isopropyl-ß-D-thiogalactopyranoside), and incubation was continued at 18°C for 20 h. The cells were then harvested by centrifugation, and the pellet was stored at –80°C. All subsequent procedures were performed at 4°C. Thawed bacterial pellets were resuspended in 50 ml of lysis buffer A (50 mM potassium phosphate buffer [pH 7.5], 500 mM NaCl, 20 mM imidazole, 0.01 M ß-mercaptoethanol, protease inhibitor cocktail [Roche Diagnostics]), and cell lysis was achieved by the addition of 1 mg of lysozyme/ml. The lysates were sonicated to reduce viscosity, and any insoluble material was removed by centrifugation at 15,000 x g for 45 min.
The soluble extract was applied to a 5-ml Ni-affinity column (HisTrap HP; GE Healthcare) that had been equilibrated with buffer A. The column was washed with the same buffer and then eluted stepwise with the same buffer containing 50, 100, 200, 300, 400, or 500 mM imidazole. The recombinant Abz2 polypeptide was retained in the column and was recovered mainly in the 300 mM imidazole eluate. After desalting on a PD-10 column (GE Healthcare) the eluate was loaded onto a 5-ml MonoQ HR 5/5 column (0.5 x 5-cm HR 5/5, ÅKTA FPLC System; GE Healthcare), which was equilibrated with buffer B (50 mM potassium phosphate buffer [pH 7.5], 50 mM NaCl, 0.01 M ß-mercaptoethanol). The column was then washed with 5 ml of the same buffer, and the chromatography was developed with a 25-ml linear gradient 50 to 500 mM NaCl in buffer B. Fractions from MonoQ chromatographies containing apparently pure Abz2p were pooled and desalted on a PD-10 column, and glycerol was added (10% [vol/vol] final concentration) prior to storage at –80°C. The purity of the protein was checked by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (26). The protein concentration was determined by the Bio-Rad dye binding method, using bovine serum albumin as standard (Bio-Rad).
Enzyme assays. Stock solutions (5 mM) of chorismic acid (Sigma) were extracted three times with diethyl ether to remove contaminating 4-hydroxybenzoate. L-Glutamine and PABA, obtained from Sigma, were used without any additional purification. ADC lyase activity was determined as described previously with minor modifications (14). Standard glutamine-dependent assays designed to generate the intermediate ADC contained 50 mM Tris-HCl (pH 7.5), 5 mM MgCl2, 10 mM dithiothreitol, 200 mM chorismate, 5 mM L-glutamine, 3% glycerol, and 15 µg of recombinant yeast PABA synthase (provided by E. Fernandez, Universidad de Salamanca, Spain) and were incubated at 30°C for 2 h with total conversion of chorismate into ADC. At this time, 15 µg of purified recombinant Abz2p protein was added, and the reaction mixture was incubated at the same temperature. At different times, samples (100 µl) were removed; the reactions were stopped with 20 ml of 75% acetic acid, incubated on ice for 1 h, and centrifuged (15,000 x g, 4°C, 15 min). Reaction controls lacking PABA synthase, Abz2p, or both proteins were also performed. The supernatant was separated isocratically on a 250-by-4.6-mm C18 reverse-phase column (Bio-Sil C18 HL 90-5 S; Bio-Rad) with 5% (vol/vol) acetic acid as the mobile phase, and the elution of chorismate, ADC, and PABA was monitored at 280 nm. The reaction products were identified and quantified by their UV absorption spectra (30) and elution times relative to standards.
Molecular mass determination. The apparent native molecular mass of purified yeast recombinant ADC lyase was determined via blue native gel electrophoresis and gel filtration chromatography. Gel filtration chromatography was performed on a Superdex 200 HR 10/30 GL column (ÅKTA System; GE Healthcare) calibrated with a MWGF200 kit for molecular weights from Sigma. Blue native gel electrophoresis was done as previously described (39) on a 4 to 16% polyacrylamide gradient gel (NativePAGE Novex; Invitrogen). For blue native gel electrophoresis NativeMark unstained protein standards (Invitrogen) were used. The method of Laemmli (26) was used for SDS-PAGE determination of the molecular mass of the Abz2 polypeptide under denaturing conditions. Identification of proteins by tryptic peptide mass fingerprinting (done by the Servicio de Proteomica, CIC, Salamanca, Spain) was performed as described previously (24).
Computational methods. Similarity searches were performed using BLAST software (1) at the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov). Protein domains or motifs were searched for in Abz2 using the InterProScan program and the InterPro database of protein families at the European Bioinformatics Institute (www.ebi.ac.uk). Multiple sequence alignments were done with CLUSTAL W (41), using the European Bioinformatics Institute tools (www.ebi.ac.uk). Molecular phylogenetic analysis was carried out by using MEGA v 3.1 software (22).
| RESULTS |
|---|
|
|
|---|
|
|
To check that ABZ2 was able to complement the deficiency of the pabC function, we constructed an E. coli pabC single-gene mutant by the PCR-based inactivation method as described in Materials and Methods (8). One
pabC mutant, designated JR3125, was verified by PCR amplification and sequencing and was selected for the complementation assays.
The deletion of the pabC gene in the JR3125 strain resulted in a severe impairment of growth in M9 minimal medium that could be rescued by the addition of PABA (200 ng/ml) to the medium (Fig. 3). The transformation of JR3125 with a YEp352-derived vector containing the complete ABZ2 ORF and 329 and 441 bp of the upstream and downstream regions, respectively, was also able to restore the ability to grow in the absence of PABA up to nearly the wild-type rate of growth (Fig. 3). However, no complementation was seen in the pabC deletion mutant transformed with the empty vector. These results show that the ABZ2 gene is the yeast functional homologue of the prokaryotic pabC gene.
|
pabC mutant restored growth on M9 medium lacking PABA and resulted in a 50-fold increase in ADC lyase activity in E. coli whole-cell extracts (not shown). The Abz2p recombinant protein was purified as described in Materials and Methods and used in in vitro ADC lyase assays. Because the 4-amino-4-deoxychorismate substrate was not commercially available, we prepared it enzymatically from chorismate and glutamine using recombinant ADC synthase from yeast in a coupled assay. ADC synthase, the product of ABZ1, catalyzes the synthesis of 4-amino-4-deoxychorismate by replacing the hydroxyl group of chorismate with an amino group acid supplied by glutamine (9). The substrate chorismate, the intermediate ADC, and the final product PABA all absorb at 280 nm but can be readily separated by reversed-phase high-pressure liquid chromatography (HPLC). We confirmed this chromatographic separation with elution times comparable to that reported previously (14). Therefore, after HPLC separation it is possible to determine the conversion of chorismate to ADC due to the enzymatic action of Abz1p; subsequent addition of ADC lyase to the reaction mixture can be used to analyze the conversion of the ADC intermediate to PABA. Addition to the reaction mixture of purified Abz1p led to a decrease in chorismate and the concomitant formation of ADC. After 2 h of incubation almost a total conversion of chorismate into ADC was achieved (Fig. 4). At this time, purified Abz2p protein was added to the reaction mixture. The presence of Abz2p catalyzed the conversion of ADC into PABA in a time-dependent manner. Control reactions revealed that ADC synthase and ADC lyase enzymatic activities were dependent on the presence of Abz1 and Abz2 proteins, respectively (data not shown). Thus, these results show that ABZ2 encodes a functional ADC lyase that catalyzes the last step in the synthesis of PABA of the folic acid pathway.
|
|
Fungal ADC lyases are distantly related to prokaryotic and plant ADC lyases. A BLASTp search of the whole GenBank database with the deduced protein product of ABZ2 detected as the closest homologues a group of proteins of unknown function belonging to different fungal species. These proteins show sufficient homology to Abz2p (identity percentages ranging from 37% for Ashbya gossypii to 26% for Neurospora crassa) to predict that they represent authentic ADC lyases in those fungal species (Fig. 6A). Strikingly, specialized BLAST searches with Abz2p restricted to the bacterial or plant entries of the GenBank database failed to detect homologues, although experimentally characterized ADC lyases have been described in E. coli, tomato, and Arabidopsis thaliana. Phylogenetic analysis of representative ADC lyase sequences confirmed that the fungal ADC lyase group clustered well apart from the bacterial and plant ADC lyase groups, although clearly belonging to an ADC lyase subfamily of proteins that is divergent from the structurally related branched-chain amino acid aminotransferase family (Fig. 6B). In fact, a search of the InterPro database (36) for domains or protein motifs present in Abz2p revealed the presence of a domain characteristic of the amino acid aminotransferase-like pyridoxal phosphate-dependent enzymes. In addition to ADC lyases, this superfamily of proteins also encompasses branched-chain amino acid aminotransferases and prokaryotic D-aminotransferases, which are characterized by the presence of a pyridoxal phosphate-binding site located at the interface of a large and a small domain linked by a flexible loop (29). Important residues that are believed to be catalytically essential in ADC lyases are all conserved in Abz2p, as well as in the fungal homologues analyzed in the present study (Fig. 6A).
|
| DISCUSSION |
|---|
|
|
|---|
Large-scale analyses have proved to be useful tools in providing functional clues to the set of still uncharacterized genes (3). In particular, chemical genetic profiling, which simultaneously probes the sensitivity of all deletion strains to a small molecule—often a metabolic inhibitor—has the advantage of inherently revealing phenotypes (12, 33). Here we performed a chemical genomic screening to identify the spectrum of genes whose deletion alters the fitness profile in the presence of the PABA antimetabolite sulfanilamide, both in the yeast nonessential haploid and in essential heterozygous sets. Essential heterozygous gene deletion mutants showing increased sensitivity to a drug might represent genes whose products are direct drug targets, genes that exhibit synthetic interactions with the drug target and that are upstream or downstream in the therapeutically relevant pathway, or genes encoding proteins involved in the transport or metabolism of the drug.
Although a detailed analysis of all of the functional categories disturbed by sulfanilamide is beyond of the scope of the present study, it is worth noting that in our screening we were able to identify a significant number of genes involved in folate/one-carbon metabolism. The sublethal concentration of the sulfa drug used in the screening probably competes with PABA and dihydrofolate (34), therefore reducing the pool of folate cofactors and affecting a variety of biosynthetic pathways dependent on one-carbon transfer, including the synthesis of purines, thymidylate, N-formylmethionyl-tRNA, and some amino acids. Indeed, the screening identified a broad range of gene functions affected by sulfanilamide-induced cytotoxicity (Table 1). As expected, we found a significant number of mutants involved directly or indirectly in one-carbon/folate metabolism (abz1, aro1, and fol2), sulfur metabolism (ckb1, ckb2, gsh1, hrt1, met6, met18, met28, and met30), and nucleotide metabolism (ade6, adk1, cdc8, guk1, pho2, rib3, rnr2, and trm7), highlighting the validity of our experimental approach.
Folate pool depletion indirectly blocks dTMP production, leading to dTTP depletion, misincorporation of uracil into DNA during replication, and imbalance in deoxynucleoside triphosphate pools, ultimately causing DNA damage and cytotoxicity due to the so-called "thymineless death" (23, 25). Interestingly, the screening reproducibly yielded mutants lacking deoxynucleoside monophosphate kinase activities (adk1, cdc8, and guk1) or defective in other regulatory or enzymatic functions of nucleotide metabolism (ade6, pho2, and rnr2). This presumably reflects the detrimental effects of the nucleotide imbalance in the presence of the folate depletant agent. Moreover, DNA repair and DNA replication mutants (fyv6, ino80, rad52, rfc2, and rrm3, and DNA polymerase
subunits cdc2, hys2, and pol32), as well as mutants involved in chromatin modification (arp5, arp8, gcn5, rsc6, rtt109, sgf20, snf2, spt3, sth1, and swd1), are also severely compromised by the sulfa drug, as expected from the damaging cycles of uracil DNA misincorporation and attempted DNA repair of deoxyuridine residues.
We presume that the sulfonamide hypersensitivity of some mutants involved in cell homeostasis and vesicular transport is likely to be unspecific, since these mutants are affected in processes related to drug or stress responses and show pleiotropic defects in the presence of different insults (32, 45).
Several unexpected mutants involved in lipid metabolism and its regulation were also susceptible to sulfanilamide treatment. Of particular interest are the mutants affected in ergosterol biosynthesis, which—besides its role in membrane fluidity and permeability—have been linked to folate metabolism via S-adenosyl-L-methionine (31).
All of these observations reflect the complex phenotypes caused by sulfanilamide-mediated folate depletion, due directly to a one-carbon unit deficiency and indirectly affecting other processes, since many methylated molecules such as nucleic acids, proteins, and lipids are formed by transmethylation reactions with S-adenosyl-L-methionine. It is noteworthy that our findings could open new fields for exploring novel treatments for several bacterial, fungal, and protozoan infections because the combination of sulfa drugs with inhibitors of some of the sulfanilamide-compromised processes found could render these pathogens sensitive to combined therapy. Further research will be required to assess precisely how the genes identified influence the response to sulfanilamide treatment.
Among the genes whose deletion elicits sulfanilamide hypersensitivity, YHI9 and YMR289w lack specific physiological functions. The three-dimensional crystal structure of Yhi9p has recently been determined, and it is classified as a member of the PhzF (PF02567) enzyme family that might use either chorismate or an anthranilate derivative as a substrate (27). No functional or structural data on YMR289w were available prior to this work.
Here we have demonstrated that the YMR289w ORF (ABZ2 gene) of S. cerevisiae encodes an enzyme responsible for the last of the two steps in the PABA branch of the folate biosynthetic pathway. Heterologous complementation of an E. coli pabC mutation and direct enzymatic characterization of the Abz2 protein support this notion. Yeast abz2 mutants impaired in the synthesis of PABA are able to grow on minimal medium supplemented either with PABA or with folic acid, indicating that this metabolite does not have an essential function other than its role as a substrate in the synthesis of folates.
Yeast mutants deleted in ABZ2 appear to be leaky for PABA auxotrophy. This characteristic, also observed in E. coli pabC mutants (13), has tacitly been attributed to the fact that ADC is unstable and is spontaneously converted to PABA in a nonenzymatic form (40). However, the apparent leakiness of the abz2 mutants seems to be due to the existence in the cells of a PABA or a folate pool sufficient to support the growth and division of the cells for several generations. As described here, subculturing of the abz2 mutant in medium lacking PABA or folate exacerbates its PABA auxotrophy, presumably because of the depletion of existing PABA or folate pools. In plants, most of the endogenous PABA content is not present as free acid but as a glucose ester (p-aminobenzoyl-ß-D-glucopyranoside [PABA-Glc]). This conjugated PABA-Glc form is accumulated in the cytoplasm and has been proposed to serve as an accessible storage depot of PABA for use as a substrate to sustain the biosynthesis of folate that takes place in mitochondria (37). Although the formation of PABA-Glc has been not detected in yeast (37), it is likely that an equivalent storage form of PABA necessary to drive its transport to mitochondria would exist in this organism.
Although the analysis of S. cerevisiae ADC lyase revealed that the protein has no significant sequence homology to its bacterial or plant counterparts, the yeast enzyme does contain a domain typical of the class IV amino acid aminotransferases family (36). Furthermore, all of the residues proposed to be catalytically essential in E. coli ADC lyase (29) are also present in Abz2p (Fig. 6A). Thus, the conserved lysine residue that covalently binds pyridoxal phosphate can be found in position 251 in the yeast enzyme. Also present are residues Arg107 and Glu297, which may directly interact with the enzyme and play a critical role in the catalytic function. Finally, the carboxylate groups of ADC could be recognized by Asn360 and Arg182, and the cyclohexadiene moiety could make van der Waals contact with the side chain of Leu358 (Fig. 6A).
Yeast ADC lyase appears to form dimers, a structural characteristic that is also shared by the E. coli and A. thaliana ADC lyases (5, 13, 29). Whereas the prokaryotic and plant enzymes have been detected only in their dimeric form, our analyses using blue native electrophoresis and size exclusion chromatography indicate that the dimeric form of the enzyme is in equilibrium with the monomeric form, although only the dimers are catalytically active. This equilibrium between active dimers and inactive monomers could be the basis of a mechanism of activity regulation of this enzyme, which does not appear to be feedback regulated for PABA or folates (5, 42), and neither does its expression seem to be subject to transcriptional control (our unpublished results). Although unlikely, the possibility still exists that the presence of Abz2p monomers in the enzyme preparation could be an artifact due to the presence of an N-terminal His6 tag in the recombinant protein used in our analyses.
In contrast to plants, green fluorescent protein-tagged Abz2p is clearly located in the cytoplasm (results not shown), a finding in agreement with a previous report (21). Since Abz1p is also a cytoplasmic enzyme, it is clear that the synthesis of PABA in S. cerevisiae takes place in the cytoplasm and not inside an specific organelle, as occurs in the plastids of plants. In this respect, the presence of PABA freely distributed in the cytoplasm of fungi raises the issue of the possible existence of a specific PABA transporter in mitochondria where the tetrahydrofolate biosynthetic pathway must continue (18).
The identification in the present study of the last unknown gene involved in the biosynthesis of tetrahydrofolate in yeast enables the initiation of metabolic engineering projects aimed to the construction of valuable vitamin B9 producer strains. In particular, overexpression of the PABA biosynthetic pathway could solve one of the major constraints of folate synthesis, namely, the supply of the PABA precursor.
| ACKNOWLEDGMENTS |
|---|
We thank M. D. Sánchez and M. M. Martin for excellent technical help and N. Skinner for correcting the manuscript.
| FOOTNOTES |
|---|
Published ahead of print on 14 September 2007. ![]()
| REFERENCES |
|---|
|
|
|---|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Appl. Environ. Microbiol. | Infect. Immun. | J. Bacteriol. |
|---|---|---|
| Mol. Cell Biol. | Microbiol. Mol. Biol. Rev. | ALL ASM JOURNALS |